ID: 1088522383

View in Genome Browser
Species Human (GRCh38)
Location 11:110712900-110712922
Sequence CACCCTATCCCCAGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088522383_1088522389 12 Left 1088522383 11:110712900-110712922 CCCACCCCACTGGGGATAGGGTG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1088522389 11:110712935-110712957 GTGTCGCAGCTGTACAAATTTGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088522383 Original CRISPR CACCCTATCCCCAGTGGGGT GGG (reversed) Intronic
900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG + Exonic
900315776 1:2055693-2055715 CAACTTTTCCCCAGTGGGGATGG + Intronic
900942274 1:5807498-5807520 CACCTTCTTCCCAGTGGGGAAGG + Intergenic
903023642 1:20411665-20411687 CACCATCTCCCCAGATGGGTAGG + Intergenic
903069629 1:20720775-20720797 GACCCCATTCCCAGTGGGGCTGG + Intronic
903674517 1:25055596-25055618 CACCCTCTCCCCGGTGGTGGTGG - Intergenic
903813455 1:26047199-26047221 CTTCCTGTCCCCAGTGGTGTGGG - Intergenic
903972684 1:27129338-27129360 CAAACTATCCCCAGTGTGGTGGG - Intronic
905619969 1:39436500-39436522 CACCCTAGTCCCAATGGGGATGG - Intronic
906533154 1:46535126-46535148 AACCCTATACCCAGTGGAGATGG + Intergenic
908643492 1:66251232-66251254 CTCCATATCCCCAATGTGGTAGG + Intronic
912555579 1:110513820-110513842 CCCTCCATTCCCAGTGGGGTAGG - Intergenic
921291916 1:213666061-213666083 CCCCCTCTCGGCAGTGGGGTGGG + Intergenic
922235229 1:223717636-223717658 CACACTTTCCCCAGAGGGGAGGG + Intronic
923760368 1:236837120-236837142 CACCTTTTCACCAGTAGGGTTGG + Intronic
924436979 1:244049909-244049931 CCCCATTTACCCAGTGGGGTGGG - Intronic
1069042606 10:63710926-63710948 CCCCCTTCTCCCAGTGGGGTGGG - Intergenic
1069903497 10:71719325-71719347 CACCCTGGCCCCAGTGGGAAGGG - Intronic
1069918272 10:71800440-71800462 CACCCCATCCCCAGGTAGGTTGG + Intronic
1070400611 10:76050432-76050454 CACCCTGGCCCCACTGGGGCAGG + Intronic
1070841508 10:79490962-79490984 CACCTTCTACCCAGTGTGGTGGG + Intergenic
1072197656 10:93130365-93130387 CTCAGTTTCCCCAGTGGGGTTGG + Intergenic
1072834511 10:98696578-98696600 GACCCTCGCCCCAGTGGTGTGGG - Intronic
1073176462 10:101560336-101560358 ATCCCTTTCCCCAGTGGGGTTGG + Intergenic
1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG + Intergenic
1077091995 11:782769-782791 CACCCTCTCAGCAGTGGGGAGGG + Intronic
1078641760 11:13103451-13103473 CCCCCTTTCCCCAGTGAAGTTGG + Intergenic
1083155837 11:60822279-60822301 CATCCAATCCCATGTGGGGTGGG - Intergenic
1083297942 11:61725333-61725355 AACCCCATCCCCAGTGGGTCTGG - Intronic
1083306175 11:61762969-61762991 CCCCCTATCCCGAGGGAGGTGGG + Intronic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1083629907 11:64090120-64090142 CACCCTCTCCCCACGGGGCTAGG + Intronic
1085532602 11:77200918-77200940 CACCCTGTCCTCAGTGGGGAGGG + Intronic
1088522383 11:110712900-110712922 CACCCTATCCCCAGTGGGGTGGG - Intronic
1089448414 11:118572494-118572516 ACCCCTATCCCCAGTGGAGCCGG + Exonic
1091836209 12:3587971-3587993 CAACACATCCTCAGTGGGGTGGG + Intronic
1096517362 12:52164357-52164379 CACCTTATCCCTAGTCAGGTTGG - Intergenic
1096651004 12:53061949-53061971 CACCCAAACCTGAGTGGGGTGGG + Intronic
1096772058 12:53941386-53941408 CCCCCAATCCACAGTGGGTTTGG - Intronic
1100441221 12:94618910-94618932 CCCCCTATTGGCAGTGGGGTAGG - Intronic
1107110398 13:36691396-36691418 CACCATGTGCCCAGTGGGGTGGG - Intronic
1107469879 13:40681950-40681972 CAGCCAGTTCCCAGTGGGGTAGG - Intergenic
1117630253 14:57683854-57683876 CACCCCAACCCCAGAGGAGTTGG - Intronic
1120228712 14:81819775-81819797 TCCCCTATCCTCAGTTGGGTAGG - Intergenic
1120530125 14:85621943-85621965 CTCCATATCCACAGTGGGGGTGG + Exonic
1124229992 15:27936240-27936262 CACCCACTCCACAGTTGGGTGGG + Intronic
1126353653 15:47771568-47771590 CACCTTCGCCCCAGTGGGGGTGG - Exonic
1127844359 15:62856674-62856696 CACCCTACCCACAGTGGTGTTGG + Intergenic
1128308142 15:66613573-66613595 CATCCTTTTCCAAGTGGGGTTGG + Intronic
1128525154 15:68407262-68407284 AATCCTGTCCCCAGTGAGGTTGG - Intronic
1133495834 16:6316175-6316197 CATCCTATACCCAAGGGGGTTGG - Intronic
1139348980 16:66323463-66323485 CCCCTTATTCCCAGTGGGGCTGG + Intergenic
1141162368 16:81638028-81638050 AACCTAATCCCCAGTGGGGGGGG - Intronic
1141702702 16:85649874-85649896 CCCTCTATCCCCAGAGGTGTGGG + Intronic
1203141765 16_KI270728v1_random:1771622-1771644 CACACTCTCCCCACTGGGGCTGG - Intergenic
1203141836 16_KI270728v1_random:1771879-1771901 CACACTCTCCCCACTGGGGCTGG - Intergenic
1142919930 17:3176070-3176092 AACCCAATCCAAAGTGGGGTGGG + Intergenic
1145961916 17:28891850-28891872 CACCTCACCCCCAGTGGGGAGGG + Intronic
1146722122 17:35130866-35130888 CACCCCTTCCCCAGTGGGGCGGG + Intronic
1146727978 17:35171013-35171035 CACCCCATCTCCAGTTGGATGGG + Intronic
1148860108 17:50600274-50600296 CACCCCATCCCCAGGGGGAATGG - Intronic
1151347138 17:73509026-73509048 CACACTGTGCCCAGAGGGGTGGG + Intronic
1151848854 17:76677739-76677761 CCCTCTCTCCCCAGTGGGCTAGG - Intronic
1152291865 17:79444347-79444369 CACCCTGAGCCCAGTGAGGTTGG + Intronic
1152538621 17:80963832-80963854 CACCCTGTCCCCTGTGCGGCCGG + Intronic
1157787204 18:50494709-50494731 CTCTCAACCCCCAGTGGGGTAGG - Intergenic
1161702772 19:5804448-5804470 ACCCCAATCCTCAGTGGGGTGGG + Intergenic
1162284755 19:9729837-9729859 CAACATATTCCTAGTGGGGTGGG + Intergenic
1162693022 19:12449448-12449470 CAGCTTGTCCACAGTGGGGTAGG - Intronic
1162936500 19:13984099-13984121 CCCTCTGTCCTCAGTGGGGTGGG + Intronic
1163063136 19:14774486-14774508 CACCCTGTCCTCATGGGGGTGGG + Intronic
1163537335 19:17884216-17884238 CACCCTAACCTCAGTGCAGTTGG - Intronic
1164040512 19:21488809-21488831 CACCCTACCCCTTGTGGGGAGGG - Intronic
1166333941 19:42094259-42094281 CACCCTTTTACCAGTGGGGTTGG + Intronic
1167198924 19:48050454-48050476 CACCCTAGCTCCTGTGCGGTTGG - Intronic
1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG + Intronic
931785238 2:65612207-65612229 CGCCATCTCCCCAGTGGGATGGG - Intergenic
932592446 2:73075491-73075513 CACCCTACCCCCAGGAGGGTTGG - Exonic
937863754 2:126732858-126732880 CACCCTCTTCCCAGTGAGGTCGG + Intergenic
941009404 2:160282363-160282385 TAGCCTTTCCCCATTGGGGTTGG + Intronic
942888144 2:180953957-180953979 AACACTATCCCAAGTAGGGTGGG + Intergenic
945572438 2:211485694-211485716 CACCCCAAACTCAGTGGGGTGGG + Intronic
947109125 2:226699586-226699608 CACCTTATCACCACTGGGGATGG - Intergenic
947912167 2:233808631-233808653 CTCCCCATCCACAGTGGGTTTGG + Intronic
1173455143 20:43195777-43195799 CACCCTGTCCCCAGTGTGCTTGG - Intergenic
1174744678 20:53049480-53049502 CATCCCATCCCCAGTGACGTAGG + Intronic
1175174437 20:57102483-57102505 CCCCCTATCTCCAGTGTGGAAGG + Intergenic
1175969551 20:62677554-62677576 CATCCTCTGCTCAGTGGGGTTGG - Intronic
1181038037 22:20179271-20179293 CACCCCATCCCCAGGAGGGAGGG + Intergenic
1181150997 22:20883470-20883492 GACCCTGTCCCCAGAGGGGCTGG + Exonic
1182738791 22:32551195-32551217 CAGCCTTTCCCCAGTGGCCTTGG - Intronic
1182795281 22:32987181-32987203 CACTCCACCCCCAGTGGGGGTGG - Intronic
1183668230 22:39257230-39257252 CTCCATTACCCCAGTGGGGTAGG - Intergenic
951075094 3:18381106-18381128 CACCCTATCCCCACATGGGAGGG - Intronic
952450711 3:33430075-33430097 CCCCCTATCCTCAGTGAGGGTGG - Intronic
953407547 3:42666911-42666933 GCTCCTATCCCCAGTGGGGCAGG - Intergenic
953828166 3:46272157-46272179 CACCCTACCCCCAGTGCAGCTGG - Intergenic
955195312 3:56800701-56800723 CAGCCTTTCCCCAGTGGTGGTGG + Intronic
958661110 3:97068687-97068709 AACCCTAACCCCAGTGTGATAGG + Intronic
961720972 3:128895775-128895797 CACCTTCTCCCCACTGGGCTTGG + Intronic
963541172 3:146590705-146590727 CACCCTATCCCCAAAGGATTTGG - Intronic
965653708 3:170961178-170961200 CACCCTACCCCAATGGGGGTAGG + Intergenic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
966207952 3:177423829-177423851 CACCCTGTGCCAAGTGGGGAGGG - Intergenic
982772940 4:159414774-159414796 CACCGTATACCCTGTGGGGAAGG + Intergenic
986716936 5:10531592-10531614 CACCCTTTGGCCTGTGGGGTTGG - Intergenic
992657001 5:78920626-78920648 CACCCCATCCCCTGTGGTGGAGG - Intronic
993745817 5:91595653-91595675 CACCCCATCCCCAGAAGAGTAGG - Intergenic
996388853 5:122938266-122938288 GACCCTCTCCCCAGTGAGTTTGG + Intronic
1006734350 6:36262056-36262078 CACCCCCTCCCCAGTGGAGAAGG - Intronic
1010490317 6:76468227-76468249 GAGCATTTCCCCAGTGGGGTGGG - Intergenic
1014169350 6:118261834-118261856 CATCCCAGCCCCAGAGGGGTGGG - Intronic
1016207017 6:141480608-141480630 CAAGATATCCCCAGTGTGGTTGG + Intergenic
1017718833 6:157230934-157230956 CTCCCCATCCCCACTGGTGTTGG - Intergenic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1018573279 6:165233046-165233068 CACCCCATCTCCATTGGGTTAGG - Intergenic
1018667224 6:166149711-166149733 CAACATCTGCCCAGTGGGGTTGG - Intergenic
1020130417 7:5556093-5556115 CTCACGCTCCCCAGTGGGGTGGG - Intronic
1022616277 7:31933691-31933713 CTCACTATCACCAATGGGGTTGG - Intronic
1024219079 7:47273744-47273766 CATCCTGTCCCCAGGGAGGTAGG - Intergenic
1024613270 7:51085188-51085210 CTCCTTATCCTCAGTGCGGTTGG + Exonic
1029098494 7:98107512-98107534 CAGCCTATCCCGGGAGGGGTCGG - Intronic
1031983760 7:128148792-128148814 CACCCCTACCCCAGTGGGATAGG - Intergenic
1031997632 7:128243006-128243028 TACCCCATCCCCACCGGGGTAGG + Intronic
1037446271 8:18968927-18968949 AAACGTATCCCCAGTGGTGTTGG - Intronic
1037913585 8:22758783-22758805 CACCCTGTCCGCAGTATGGTGGG + Intronic
1039208471 8:35184112-35184134 CAGCCTGTCCCCACCGGGGTTGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039728867 8:40252979-40253001 CACCCCAACCCCAGTTGTGTTGG - Intergenic
1043171593 8:76972838-76972860 CTCCTTAGCCCCAGTGGGGTGGG - Intergenic
1047191539 8:122683116-122683138 CAGCCTCTCCCCAGAAGGGTGGG - Intergenic
1055422940 9:76162801-76162823 ACCCCTACCCCCAGAGGGGTAGG - Intronic
1059685550 9:116632078-116632100 CACTCTATCACCAGTGTGGAGGG - Intronic
1061385096 9:130285067-130285089 CTCCCTATGCCCAGTGGTTTTGG + Intronic
1061401443 9:130370516-130370538 CACTCTCTACCCAGGGGGGTGGG - Intronic
1185550834 X:981335-981357 CACACTCTCCCCACTGGGGCTGG + Intergenic
1199705540 X:150421873-150421895 CTCCAGATTCCCAGTGGGGTTGG - Intronic