ID: 1088526650

View in Genome Browser
Species Human (GRCh38)
Location 11:110763066-110763088
Sequence TTCTTATTGTGATCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088526650_1088526652 29 Left 1088526650 11:110763066-110763088 CCAGGTTTTGATCACAATAAGAA No data
Right 1088526652 11:110763118-110763140 TGGTACATCACTCTTTGCAGTGG No data
1088526650_1088526651 9 Left 1088526650 11:110763066-110763088 CCAGGTTTTGATCACAATAAGAA No data
Right 1088526651 11:110763098-110763120 TCTCATTATATATCTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088526650 Original CRISPR TTCTTATTGTGATCAAAACC TGG (reversed) Intergenic
No off target data available for this crispr