ID: 1088526723

View in Genome Browser
Species Human (GRCh38)
Location 11:110763743-110763765
Sequence TTGGCCAGTGACTGGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088526723_1088526729 0 Left 1088526723 11:110763743-110763765 CCTGGCAGCCAGTCACTGGCCAA No data
Right 1088526729 11:110763766-110763788 CACAGCAAAAGTGGGGAGTAAGG No data
1088526723_1088526727 -7 Left 1088526723 11:110763743-110763765 CCTGGCAGCCAGTCACTGGCCAA No data
Right 1088526727 11:110763759-110763781 TGGCCAACACAGCAAAAGTGGGG No data
1088526723_1088526726 -8 Left 1088526723 11:110763743-110763765 CCTGGCAGCCAGTCACTGGCCAA No data
Right 1088526726 11:110763758-110763780 CTGGCCAACACAGCAAAAGTGGG No data
1088526723_1088526725 -9 Left 1088526723 11:110763743-110763765 CCTGGCAGCCAGTCACTGGCCAA No data
Right 1088526725 11:110763757-110763779 ACTGGCCAACACAGCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088526723 Original CRISPR TTGGCCAGTGACTGGCTGCC AGG (reversed) Intergenic
No off target data available for this crispr