ID: 1088528559

View in Genome Browser
Species Human (GRCh38)
Location 11:110784198-110784220
Sequence ACATAGGGATTATGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088528554_1088528559 18 Left 1088528554 11:110784157-110784179 CCAAATTAAAGTAATAATTCTAT No data
Right 1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG No data
1088528553_1088528559 19 Left 1088528553 11:110784156-110784178 CCCAAATTAAAGTAATAATTCTA No data
Right 1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088528559 Original CRISPR ACATAGGGATTATGGGAAAA TGG Intergenic
No off target data available for this crispr