ID: 1088535053

View in Genome Browser
Species Human (GRCh38)
Location 11:110851520-110851542
Sequence TGATGCTAATATAGTGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088535051_1088535053 24 Left 1088535051 11:110851473-110851495 CCTTTGGTACAGATTCAAGGACA No data
Right 1088535053 11:110851520-110851542 TGATGCTAATATAGTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088535053 Original CRISPR TGATGCTAATATAGTGACCT AGG Intergenic
No off target data available for this crispr