ID: 1088536245

View in Genome Browser
Species Human (GRCh38)
Location 11:110865339-110865361
Sequence ATCTCCTTCTAAAAGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088536245_1088536252 26 Left 1088536245 11:110865339-110865361 CCCTTATTCTTTTAGAAGGAGAT No data
Right 1088536252 11:110865388-110865410 TTCCTAGAGGAATGTCTCTAAGG No data
1088536245_1088536251 13 Left 1088536245 11:110865339-110865361 CCCTTATTCTTTTAGAAGGAGAT No data
Right 1088536251 11:110865375-110865397 GGCTAAGGTAGTTTTCCTAGAGG No data
1088536245_1088536248 -8 Left 1088536245 11:110865339-110865361 CCCTTATTCTTTTAGAAGGAGAT No data
Right 1088536248 11:110865354-110865376 AAGGAGATTCCTATGGAGAAAGG No data
1088536245_1088536249 -2 Left 1088536245 11:110865339-110865361 CCCTTATTCTTTTAGAAGGAGAT No data
Right 1088536249 11:110865360-110865382 ATTCCTATGGAGAAAGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088536245 Original CRISPR ATCTCCTTCTAAAAGAATAA GGG (reversed) Intergenic
No off target data available for this crispr