ID: 1088544614

View in Genome Browser
Species Human (GRCh38)
Location 11:110947004-110947026
Sequence ATGTGCCAGGCAAAGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088544614_1088544618 -5 Left 1088544614 11:110947004-110947026 CCCTCACACTTTGCCTGGCACAT No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088544614 Original CRISPR ATGTGCCAGGCAAAGTGTGA GGG (reversed) Intergenic
No off target data available for this crispr