ID: 1088544618

View in Genome Browser
Species Human (GRCh38)
Location 11:110947022-110947044
Sequence CACATGGAAGTGACTCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088544611_1088544618 29 Left 1088544611 11:110946970-110946992 CCAGCTTCCATGGGAGTGGGAAT No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data
1088544612_1088544618 22 Left 1088544612 11:110946977-110946999 CCATGGGAGTGGGAATGTTCATA No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data
1088544614_1088544618 -5 Left 1088544614 11:110947004-110947026 CCCTCACACTTTGCCTGGCACAT No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data
1088544615_1088544618 -6 Left 1088544615 11:110947005-110947027 CCTCACACTTTGCCTGGCACATG No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data
1088544610_1088544618 30 Left 1088544610 11:110946969-110946991 CCCAGCTTCCATGGGAGTGGGAA No data
Right 1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088544618 Original CRISPR CACATGGAAGTGACTCTAAA TGG Intergenic
No off target data available for this crispr