ID: 1088550811

View in Genome Browser
Species Human (GRCh38)
Location 11:111010625-111010647
Sequence TGCTAAGGAGGCAGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088550806_1088550811 28 Left 1088550806 11:111010574-111010596 CCAAGTATGAGCTGATGAGCATG No data
Right 1088550811 11:111010625-111010647 TGCTAAGGAGGCAGCTCCCATGG No data
1088550805_1088550811 29 Left 1088550805 11:111010573-111010595 CCCAAGTATGAGCTGATGAGCAT No data
Right 1088550811 11:111010625-111010647 TGCTAAGGAGGCAGCTCCCATGG No data
1088550807_1088550811 5 Left 1088550807 11:111010597-111010619 CCTTTTGTCAACAACTGTTTAGT No data
Right 1088550811 11:111010625-111010647 TGCTAAGGAGGCAGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088550811 Original CRISPR TGCTAAGGAGGCAGCTCCCA TGG Intergenic