ID: 1088552524

View in Genome Browser
Species Human (GRCh38)
Location 11:111027417-111027439
Sequence AATTATCCAGAGCTGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088552521_1088552524 9 Left 1088552521 11:111027385-111027407 CCCAGGAACTCATACAGAGTCTT 0: 17
1: 36
2: 74
3: 113
4: 260
Right 1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG No data
1088552522_1088552524 8 Left 1088552522 11:111027386-111027408 CCAGGAACTCATACAGAGTCTTT No data
Right 1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG No data
1088552519_1088552524 28 Left 1088552519 11:111027366-111027388 CCACAAAGATTGTCTATAACCCA No data
Right 1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG No data
1088552518_1088552524 29 Left 1088552518 11:111027365-111027387 CCCACAAAGATTGTCTATAACCC No data
Right 1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088552524 Original CRISPR AATTATCCAGAGCTGAAGCA AGG Intergenic
No off target data available for this crispr