ID: 1088553210

View in Genome Browser
Species Human (GRCh38)
Location 11:111035941-111035963
Sequence GTTCTACACACTGAGGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088553210_1088553217 20 Left 1088553210 11:111035941-111035963 CCAGAACCCTCAGTGTGTAGAAC No data
Right 1088553217 11:111035984-111036006 GAGAAGTAGCAGAGTCTGCCAGG No data
1088553210_1088553218 27 Left 1088553210 11:111035941-111035963 CCAGAACCCTCAGTGTGTAGAAC No data
Right 1088553218 11:111035991-111036013 AGCAGAGTCTGCCAGGCTACAGG No data
1088553210_1088553219 28 Left 1088553210 11:111035941-111035963 CCAGAACCCTCAGTGTGTAGAAC No data
Right 1088553219 11:111035992-111036014 GCAGAGTCTGCCAGGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088553210 Original CRISPR GTTCTACACACTGAGGGTTC TGG (reversed) Intergenic
No off target data available for this crispr