ID: 1088553954

View in Genome Browser
Species Human (GRCh38)
Location 11:111042824-111042846
Sequence TAGAAAAAGGAGGAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088553949_1088553954 14 Left 1088553949 11:111042787-111042809 CCTTGGAACTAAAAAATAAGTTT No data
Right 1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088553954 Original CRISPR TAGAAAAAGGAGGAAGAGGC TGG Intergenic
No off target data available for this crispr