ID: 1088556357

View in Genome Browser
Species Human (GRCh38)
Location 11:111065289-111065311
Sequence TACGATGTCCTCTGTAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088556357_1088556359 -2 Left 1088556357 11:111065289-111065311 CCTCTGCTACAGAGGACATCGTA No data
Right 1088556359 11:111065310-111065332 TAGAGGAATGAACAAAGTCAAGG No data
1088556357_1088556360 4 Left 1088556357 11:111065289-111065311 CCTCTGCTACAGAGGACATCGTA No data
Right 1088556360 11:111065316-111065338 AATGAACAAAGTCAAGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088556357 Original CRISPR TACGATGTCCTCTGTAGCAG AGG (reversed) Intergenic
No off target data available for this crispr