ID: 1088565584

View in Genome Browser
Species Human (GRCh38)
Location 11:111169098-111169120
Sequence CTGTTTTCACTCAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088565584_1088565589 28 Left 1088565584 11:111169098-111169120 CCTTGCTCTTTGAGTGAAAACAG No data
Right 1088565589 11:111169149-111169171 ACTATGTTTTAGGAGGTCCTGGG No data
1088565584_1088565586 18 Left 1088565584 11:111169098-111169120 CCTTGCTCTTTGAGTGAAAACAG No data
Right 1088565586 11:111169139-111169161 CAGATGAGAAACTATGTTTTAGG No data
1088565584_1088565588 27 Left 1088565584 11:111169098-111169120 CCTTGCTCTTTGAGTGAAAACAG No data
Right 1088565588 11:111169148-111169170 AACTATGTTTTAGGAGGTCCTGG No data
1088565584_1088565587 21 Left 1088565584 11:111169098-111169120 CCTTGCTCTTTGAGTGAAAACAG No data
Right 1088565587 11:111169142-111169164 ATGAGAAACTATGTTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088565584 Original CRISPR CTGTTTTCACTCAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr