ID: 1088568345

View in Genome Browser
Species Human (GRCh38)
Location 11:111196764-111196786
Sequence TCCCCTAGTTGGAGTTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088568343_1088568345 -10 Left 1088568343 11:111196751-111196773 CCTGAGTTCTTGATCCCCTAGTT No data
Right 1088568345 11:111196764-111196786 TCCCCTAGTTGGAGTTCAGCAGG No data
1088568340_1088568345 30 Left 1088568340 11:111196711-111196733 CCATCTTCATTGAGACCACTCAG No data
Right 1088568345 11:111196764-111196786 TCCCCTAGTTGGAGTTCAGCAGG No data
1088568341_1088568345 15 Left 1088568341 11:111196726-111196748 CCACTCAGTCAGAGAAACTTTTA No data
Right 1088568345 11:111196764-111196786 TCCCCTAGTTGGAGTTCAGCAGG No data
1088568342_1088568345 -9 Left 1088568342 11:111196750-111196772 CCCTGAGTTCTTGATCCCCTAGT No data
Right 1088568345 11:111196764-111196786 TCCCCTAGTTGGAGTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088568345 Original CRISPR TCCCCTAGTTGGAGTTCAGC AGG Intergenic
No off target data available for this crispr