ID: 1088572000

View in Genome Browser
Species Human (GRCh38)
Location 11:111231408-111231430
Sequence AGGTTTCTAGAGGTGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088572000_1088572010 9 Left 1088572000 11:111231408-111231430 CCTCACTCCACCTCTAGAAACCT No data
Right 1088572010 11:111231440-111231462 GGGAAATTTCAAGCATTCAAAGG No data
1088572000_1088572012 24 Left 1088572000 11:111231408-111231430 CCTCACTCCACCTCTAGAAACCT No data
Right 1088572012 11:111231455-111231477 TTCAAAGGATCAGACAGGAGAGG No data
1088572000_1088572013 27 Left 1088572000 11:111231408-111231430 CCTCACTCCACCTCTAGAAACCT No data
Right 1088572013 11:111231458-111231480 AAAGGATCAGACAGGAGAGGTGG No data
1088572000_1088572011 19 Left 1088572000 11:111231408-111231430 CCTCACTCCACCTCTAGAAACCT No data
Right 1088572011 11:111231450-111231472 AAGCATTCAAAGGATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088572000 Original CRISPR AGGTTTCTAGAGGTGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr