ID: 1088575557

View in Genome Browser
Species Human (GRCh38)
Location 11:111267736-111267758
Sequence GAGAATTCCAGACACCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088575557_1088575561 -2 Left 1088575557 11:111267736-111267758 CCCCCGTGGTGTCTGGAATTCTC 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1088575561 11:111267757-111267779 TCTCATAGTTGTACACACTGTGG 0: 1
1: 0
2: 0
3: 22
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088575557 Original CRISPR GAGAATTCCAGACACCACGG GGG (reversed) Intronic
900959846 1:5911909-5911931 GAGTCTTCCAAAAACCACGGTGG + Intronic
901842841 1:11964638-11964660 GCACATTCCAGACACCACTGTGG - Exonic
902942429 1:19810182-19810204 GAGAATTCAAAACACCATGGAGG - Intergenic
904286985 1:29459269-29459291 GAGAGTTTTAGACCCCACGGAGG - Intergenic
905649181 1:39645251-39645273 CAGGATTCCAGAGACCACTGTGG + Intergenic
912737494 1:112162848-112162870 GAGGATACCAGACACCACTGAGG + Intergenic
913714093 1:121516643-121516665 GAGAAACCCAAACACCATGGAGG - Intergenic
915643601 1:157250312-157250334 GAGAATTCCAGGCCCCAGGCAGG - Intergenic
916052963 1:161048971-161048993 GGGAAGTCCAGAGACCAAGGTGG - Exonic
916891836 1:169119598-169119620 GAGAACTCCAGTCAGCAAGGTGG + Intronic
922030690 1:221794667-221794689 GAGAATCCCAGACATCACTCAGG - Intergenic
923805029 1:237248180-237248202 GAGAATTGCTTAAACCACGGAGG + Intronic
1064559748 10:16584550-16584572 GAGAATACAAGCCACCACGTTGG + Intergenic
1064649662 10:17496169-17496191 GAGAATTGCAGAAACCTGGGAGG + Intergenic
1070074336 10:73120602-73120624 GTGAATTCCAGCCTCCACAGAGG + Intronic
1070308058 10:75251557-75251579 GAGAATTCCTTAAACCAGGGAGG + Intergenic
1070888927 10:79927822-79927844 AAGAAATGCAGACACCACAGTGG + Intergenic
1072496922 10:95970850-95970872 GAGAATTTAAGACACCACACTGG - Intronic
1072954130 10:99874019-99874041 GAGAATGCCTGAGACCACTGTGG - Intergenic
1073307538 10:102515083-102515105 GGCAGTTCCAGACCCCACGGGGG - Intronic
1075629904 10:123994659-123994681 GGGAACTCCTGACACCAAGGGGG - Intergenic
1076158352 10:128221507-128221529 GGGAGGTCCAGACACCAAGGTGG - Intergenic
1079696092 11:23484139-23484161 TGGAATTCCAGGCACCACTGTGG - Intergenic
1079867877 11:25758409-25758431 CAGCATTCCAGGCACCACTGGGG - Intergenic
1081190215 11:40094785-40094807 GAGAATTGCTGGCACCCCGGAGG - Intergenic
1081727411 11:45340304-45340326 GAGAAATCCAGCCACACCGGAGG + Intergenic
1082140618 11:48604077-48604099 GAGGATTTCAGACATCATGGTGG - Intergenic
1085189335 11:74604754-74604776 GAGACTGCCAGACACCAAGTAGG - Exonic
1086331972 11:85763193-85763215 GAGAATTCAGGACACCGCAGAGG + Intronic
1088542414 11:110926931-110926953 GAAAAGTCCAGAAACCAGGGGGG - Intergenic
1088575557 11:111267736-111267758 GAGAATTCCAGACACCACGGGGG - Intronic
1090233667 11:125129445-125129467 CAGAAGTCAAGATACCACGGGGG - Intergenic
1090389215 11:126376958-126376980 GAGAATACAAGGCACCAGGGGGG + Intronic
1091059866 11:132451416-132451438 GTGAATTCCTGAGACCACAGAGG + Intronic
1091079059 11:132649001-132649023 TGGAATTCCAGAGGCCACGGAGG + Intronic
1093244180 12:16715047-16715069 GAGAATTTCATTCATCACGGTGG - Intergenic
1095674208 12:44897734-44897756 GGGCATTCCAGGCACCACTGGGG - Intronic
1096109809 12:49021797-49021819 GACAATTCCAGGCTCCACAGTGG + Exonic
1096860368 12:54522774-54522796 GAGAATTCCAGTCACCCTGAAGG + Intronic
1105441223 13:20416504-20416526 CAGCATTCCAGAGCCCACGGGGG - Intronic
1106201975 13:27545646-27545668 GAGAATTTCTCAAACCACGGAGG + Intergenic
1106429396 13:29665691-29665713 TAGCATTCCAGACACCAGTGGGG - Intergenic
1108998288 13:56763261-56763283 TGGTATTCCAGACACCACTGGGG - Intergenic
1110688191 13:78400007-78400029 GAAACTTCCAGTCACCAAGGTGG - Intergenic
1112749218 13:102565145-102565167 GAGAAGTTCAGACGCCATGGTGG + Intergenic
1113663591 13:112125298-112125320 GAGAAGACCAGGCACCACGATGG - Intergenic
1113749670 13:112768455-112768477 AACAACTCCAGACACCAGGGCGG - Intronic
1117068226 14:52032026-52032048 GAGAATGCCAGACACCCTGAAGG - Intronic
1118791088 14:69093827-69093849 TAGAATTCCAGACATCAAGGAGG + Intronic
1129376726 15:75138338-75138360 GGGAATCCCAGACACCCAGGAGG - Intergenic
1129680525 15:77656209-77656231 GAGAACTCCAGACCCCACTTTGG + Intronic
1130897102 15:88179913-88179935 GAGTATTCCAGTCACCAGAGAGG + Intronic
1132372155 15:101306615-101306637 GGGAATTCCAGGCACCAAGGAGG - Intronic
1133985692 16:10666336-10666358 AGGAATTCCAGGCACCACCGAGG - Intronic
1134017905 16:10902047-10902069 GAGACTGCCAGTCACCACAGTGG - Exonic
1135225283 16:20650540-20650562 GAGAAACCCAGACACCTAGGAGG + Intronic
1137262067 16:46839299-46839321 AAGTATTCCAGAGACCAAGGTGG + Intergenic
1141927862 16:87181060-87181082 GAGAATTGCTTAAACCACGGAGG + Intronic
1142433250 16:90041707-90041729 GAGAATTCCTGGCACCTGGGAGG + Intronic
1144440378 17:15275997-15276019 GAGAACTCCAGCCAGCACTGGGG - Intergenic
1146535604 17:33647928-33647950 CTGGATTCCAGACACCAGGGAGG + Intronic
1146933059 17:36791677-36791699 GATCATTCCAGACACAAGGGAGG - Intergenic
1148105076 17:45114643-45114665 AAGAATTCCAGGAACCACAGTGG - Intronic
1148238454 17:45984279-45984301 GAGAGTTCTAGACACCATGAGGG - Intronic
1150209276 17:63433359-63433381 GTGATGTGCAGACACCACGGGGG + Exonic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1153181356 18:2438409-2438431 GAAAATTTCAAACACCACAGAGG - Intergenic
1154156392 18:11947683-11947705 GAGACTGCCAGACACCCCCGTGG + Intergenic
1158441235 18:57476082-57476104 GAGGACTCCAGACGCCAGGGTGG - Intronic
1160678183 19:401433-401455 GAGGATTCCTCACCCCACGGGGG + Intergenic
1162435598 19:10656002-10656024 GAATATTCCAGACAACACTGGGG - Intronic
1164786524 19:30935494-30935516 GAGAAAACCAGCCACCACTGGGG + Intergenic
1165699633 19:37927485-37927507 GAGAATTCCAAAAACCAAGAAGG - Intronic
1168613481 19:57819532-57819554 GAGAGTTCCTGACATGACGGTGG + Intronic
926607774 2:14914709-14914731 GAGAAATCCAGACATCTCTGGGG + Intergenic
929837989 2:45425967-45425989 TGGCATTCCAGACACCACTGAGG - Intronic
933281700 2:80338811-80338833 TAGAATTCCAGTCACCAGGCAGG + Intronic
933413236 2:81951227-81951249 TGGGATTCCAGACACCACTGTGG + Intergenic
937010644 2:118559949-118559971 GAGCATTTCAGACACCAGAGTGG - Intergenic
939843027 2:147211590-147211612 TAGAATTCCAGACACAATAGAGG + Intergenic
940577469 2:155528963-155528985 GAAAATTCCAAACACCAAAGGGG + Intergenic
945025487 2:205615889-205615911 GAGAATTCCTAACACCAAGGAGG - Intronic
1175422933 20:58846830-58846852 GGGAATTCCAGCCACCCTGGGGG - Intronic
1177050253 21:16224722-16224744 TAGCATTTCAGACACCACTGGGG - Intergenic
1182490508 22:30668411-30668433 GAGAAATCCAGACTCCCCTGGGG - Intronic
1183807146 22:40221051-40221073 GAACATCCCAGACACCAGGGGGG - Intronic
1184003878 22:41694827-41694849 CAGAGATCCAGACACCAAGGTGG + Exonic
953669001 3:44946976-44946998 GAAAATTCCAGACACCACGTAGG + Intronic
957573087 3:81973557-81973579 GAGATTTCAAGACATCAGGGAGG + Intergenic
963729703 3:148959444-148959466 GAAAATGCCAGTCACCATGGAGG - Intergenic
969202921 4:5620055-5620077 GAGACCTTCAGAGACCACGGGGG + Intronic
969857822 4:10014328-10014350 GAGAATCCCAGGCACCATGTAGG - Intronic
970416081 4:15858195-15858217 GAGTTTTCCAGACAACACAGTGG - Intergenic
974008370 4:56583715-56583737 AAAAATTCCAGTCACCACTGAGG - Intronic
976065524 4:81183611-81183633 TGGCATTCCAGGCACCACGGGGG - Intronic
979421362 4:120509226-120509248 TGGCATTCCAGACACCACTGTGG - Intergenic
979487397 4:121284152-121284174 GAGAATTCCAGACCCCACCATGG + Intergenic
982733313 4:158979374-158979396 GGGCATTCCAGGCACCACTGGGG + Intronic
985605528 5:855764-855786 GAGGGTTACAGACACCACAGAGG + Intronic
985811774 5:2095213-2095235 GAGTCTTCCAGAAACCGCGGTGG + Intergenic
987427423 5:17789172-17789194 GAGAATCGCTGAAACCACGGAGG + Intergenic
1001432867 5:171677069-171677091 GAAAATGCCAGTGACCACGGGGG - Intergenic
1003498178 6:6682676-6682698 GAGAATACCAAACACTACTGTGG + Intergenic
1004022135 6:11785786-11785808 GGAAACTCCAGACACCACGTAGG + Intronic
1004444780 6:15687805-15687827 GAGAATTCCAGAGACAAGAGTGG - Intergenic
1005546326 6:26877238-26877260 GAGAATTGCTGAAACCTCGGAGG - Intergenic
1007433455 6:41790192-41790214 GGGTTTTCCAGACACCAGGGAGG + Exonic
1007540672 6:42640817-42640839 GAGAATTCCTTAAACCATGGAGG - Intronic
1010553252 6:77249136-77249158 AAGAATTCCAGAAACAAAGGAGG - Intergenic
1011184316 6:84657451-84657473 GACAATTCCAGACCCTTCGGAGG + Intergenic
1012532992 6:100261134-100261156 CAAAATTCCAGACACCAAGCAGG + Intergenic
1015166218 6:130202920-130202942 GAGAAGCCCAGTCACCACTGCGG - Intronic
1021127179 7:16864851-16864873 GTGTATTCCAGTCACCACTGAGG + Intronic
1026593205 7:71713606-71713628 GAGAAATCAAGACACAAAGGAGG - Intergenic
1031710972 7:125046419-125046441 TGGCATTCCAGACACCACGGGGG - Intergenic
1031959579 7:127976568-127976590 GAGTATTTCAGTCACCACTGTGG - Intronic
1031991323 7:128201122-128201144 GAGAGTTTCAGACACAAAGGAGG - Intergenic
1037258317 8:16979840-16979862 TAGCATTCCAGGCACCACTGGGG + Intergenic
1039942682 8:42104582-42104604 AAGAGTCCCAGACACCAGGGAGG + Intergenic
1041728165 8:61037776-61037798 GAGAACTTCAGTCACCAGGGAGG + Intergenic
1043208353 8:77476473-77476495 TAGAATTCCAGACACTGGGGTGG - Intergenic
1045480657 8:102589399-102589421 TAGAAATCCAGAAACCACGAAGG - Intergenic
1047766374 8:127993288-127993310 GTGCATTGCAGACATCACGGAGG - Intergenic
1048358091 8:133669970-133669992 GAGAATTCCTTACACCTAGGAGG + Intergenic
1050138887 9:2496738-2496760 GAGATTTCAAGACTCCAGGGTGG + Intergenic
1052344889 9:27399555-27399577 GAGTATTTCAGACACCCAGGTGG + Intronic
1055856803 9:80698169-80698191 GAGAATTCCAGCCAGCACTAAGG - Intergenic
1060238535 9:121884050-121884072 GAGAATGCCAGACACATCGCTGG + Intronic
1187316225 X:18197645-18197667 GAGAATTGCAGAAACCAGGCTGG - Intronic
1189289791 X:39876993-39877015 GAGAATTCAAGCCACCTTGGAGG + Intergenic
1189731208 X:44022927-44022949 GAGAAACCCAGATACCAAGGAGG - Intergenic
1191872966 X:65765402-65765424 TGGCATTCCAGACACCACTGGGG + Intergenic
1192410229 X:70927488-70927510 AATAATGCCAGAGACCACGGTGG + Exonic
1193949304 X:87778530-87778552 TGGAATTCCAGGCACCACTGAGG - Intergenic
1194419893 X:93660826-93660848 GGGCATTCCAGGCACCACTGGGG - Intergenic
1195062889 X:101213564-101213586 GGGAATTGCAGGCACCATGGTGG + Intergenic
1196633930 X:117978281-117978303 GAGAATTCCTCACACCATGATGG + Intronic
1198749523 X:139924640-139924662 CAAAATTCCAGACCCCAAGGAGG - Intronic
1201848580 Y:18451244-18451266 TAGCATTCCAGGCACCACTGGGG + Intergenic
1201884737 Y:18869131-18869153 TAGCATTCCAGGCACCACTGGGG - Intergenic
1202335154 Y:23801123-23801145 TAGCATTCCAGGCACCACTGCGG - Intergenic
1202535613 Y:25868936-25868958 TAGCATTCCAGGCACCACTGCGG + Intergenic