ID: 1088580383

View in Genome Browser
Species Human (GRCh38)
Location 11:111310118-111310140
Sequence CTTTGTGTATATGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088580383_1088580389 18 Left 1088580383 11:111310118-111310140 CCAACTTCCTCATATACACAAAG No data
Right 1088580389 11:111310159-111310181 TCAGTCAGACCTCGCCAAAAGGG No data
1088580383_1088580388 17 Left 1088580383 11:111310118-111310140 CCAACTTCCTCATATACACAAAG No data
Right 1088580388 11:111310158-111310180 TTCAGTCAGACCTCGCCAAAAGG No data
1088580383_1088580390 22 Left 1088580383 11:111310118-111310140 CCAACTTCCTCATATACACAAAG No data
Right 1088580390 11:111310163-111310185 TCAGACCTCGCCAAAAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088580383 Original CRISPR CTTTGTGTATATGAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr