ID: 1088583193

View in Genome Browser
Species Human (GRCh38)
Location 11:111334895-111334917
Sequence CCCGGGGACTGGGTTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088583193_1088583202 -6 Left 1088583193 11:111334895-111334917 CCAGTGGAAACCCAGTCCCCGGG No data
Right 1088583202 11:111334912-111334934 CCCGGGGAGCTGTGCAGGGCAGG No data
1088583193_1088583199 -10 Left 1088583193 11:111334895-111334917 CCAGTGGAAACCCAGTCCCCGGG No data
Right 1088583199 11:111334908-111334930 AGTCCCCGGGGAGCTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088583193 Original CRISPR CCCGGGGACTGGGTTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr