ID: 1088585586

View in Genome Browser
Species Human (GRCh38)
Location 11:111357686-111357708
Sequence CCTTCCATGTCCAGGCAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088585579_1088585586 23 Left 1088585579 11:111357640-111357662 CCAGCCGGCACACAGGGCAGCCT 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG 0: 1
1: 0
2: 2
3: 22
4: 285
1088585582_1088585586 0 Left 1088585582 11:111357663-111357685 CCTCTGTCACTGCAGACACAGAA 0: 1
1: 0
2: 1
3: 50
4: 341
Right 1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG 0: 1
1: 0
2: 2
3: 22
4: 285
1088585580_1088585586 19 Left 1088585580 11:111357644-111357666 CCGGCACACAGGGCAGCCTCCTC 0: 1
1: 0
2: 3
3: 39
4: 403
Right 1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG 0: 1
1: 0
2: 2
3: 22
4: 285
1088585581_1088585586 3 Left 1088585581 11:111357660-111357682 CCTCCTCTGTCACTGCAGACACA 0: 1
1: 0
2: 4
3: 38
4: 426
Right 1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG 0: 1
1: 0
2: 2
3: 22
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088585586 Original CRISPR CCTTCCATGTCCAGGCAGGA AGG Exonic
901002852 1:6157265-6157287 CCTCCCATGTCCAGGTATGCAGG - Intronic
903329039 1:22587763-22587785 CCTGCCATGTGCAGGGAGGCTGG - Intronic
904744607 1:32703025-32703047 CCTTCCCTGTCCAGCCTGGGAGG + Exonic
905731170 1:40300415-40300437 CCTCCATTGCCCAGGCAGGAAGG - Intergenic
907527752 1:55063669-55063691 CCCTCCATGGCCTGGCACGAGGG + Exonic
909607657 1:77522749-77522771 TCTTACAAGTCCAGGCAAGAAGG + Intronic
911906119 1:103570338-103570360 GATTCCATGTCCAGGAAGGAAGG - Intronic
912504622 1:110147823-110147845 CCTACCATATCCAGGGAAGAGGG + Intergenic
912529860 1:110312510-110312532 CCTTCCTTCCCCATGCAGGAGGG + Intergenic
916128341 1:161590756-161590778 TCTTCCATGTCGAGGAGGGAAGG - Intronic
916138260 1:161672587-161672609 TCTTCCATGTCGAGGAGGGAAGG - Intronic
917796886 1:178539077-178539099 CCCTCCATATCGAGGGAGGAAGG - Intronic
919768060 1:201140066-201140088 CCACCCATGTGCAGACAGGAGGG + Intronic
921904665 1:220484079-220484101 CCTTCCCTCTCCATGCTGGAGGG + Intergenic
922003467 1:221504268-221504290 CATTCTATGTCCAGGAAGGGTGG - Intergenic
922107395 1:222524382-222524404 CCTCCCAAGTCCAGGTGGGAGGG + Intronic
922537332 1:226390858-226390880 CTTCACATGTCCAGGCAGGTAGG - Intronic
922825770 1:228517181-228517203 CCTTAAATGTCCATGCTGGAGGG - Intergenic
1064292374 10:14047730-14047752 ACTTCCAAGTCCAGGAAGTATGG + Intronic
1065235658 10:23648945-23648967 CCTTTCAGATCCAGGCAGCAGGG + Intergenic
1067080762 10:43211041-43211063 CCTCCTCTGTTCAGGCAGGAAGG + Intronic
1067287177 10:44915003-44915025 CCCTCCATGCCCAGCCTGGACGG - Intronic
1069465680 10:68636727-68636749 TCTTCCATATCTAGGCTGGATGG - Intronic
1069894396 10:71671642-71671664 CCTGCCCTATCCAGGCAGCAGGG - Intronic
1070962492 10:80508973-80508995 TCCTCCTTGTCCAGGGAGGAGGG + Intronic
1074715455 10:116214375-116214397 CTTGCCATGGCCAGGCAGGTAGG - Intronic
1075074680 10:119342922-119342944 CCTTCTGCCTCCAGGCAGGAGGG + Intronic
1076251623 10:128988686-128988708 CCTTACATCTCCTGACAGGAAGG - Intergenic
1076314131 10:129528785-129528807 TCTGCCATGTCAAGGAAGGAAGG + Intronic
1076730674 10:132437381-132437403 CCTTCCAGGTGCAGGAAAGATGG + Intergenic
1077066340 11:642610-642632 CTTGCCCTGTCCAGGCAGGCGGG - Intergenic
1077133545 11:987126-987148 CCGGCCATCTCCAGGCAGCATGG - Intronic
1077151449 11:1074830-1074852 CCTTATATGTCCTGGCAGGAGGG - Intergenic
1077500693 11:2908603-2908625 CCTGCCGAGACCAGGCAGGAGGG + Intronic
1078851214 11:15165748-15165770 CCTGCCATGTCCACCCAGCATGG - Intronic
1079209204 11:18445941-18445963 GCTTCCTTGCCCAGGCCGGAGGG - Intronic
1079509031 11:21188444-21188466 CTTTACATGTCCAAGCTGGAAGG - Intronic
1084402918 11:68955719-68955741 GCCTCCCTGTCCAGGCTGGATGG + Intergenic
1084409374 11:68997504-68997526 TCTTCCCTCGCCAGGCAGGAAGG - Intergenic
1084446093 11:69204541-69204563 CCTTGCATCTCCAGGCAGGATGG - Intergenic
1084954883 11:72685844-72685866 GCTTCCAGGGCCAGGCAGAAGGG + Intronic
1085525382 11:77160718-77160740 CCTTCCCTGACCATGCAGCAGGG - Intronic
1085643812 11:78209815-78209837 CCTTCGATGTACAGGCTGGTGGG - Exonic
1087946336 11:104164437-104164459 CCTTACAGGTCCAACCAGGAGGG - Intergenic
1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG + Exonic
1090059559 11:123452356-123452378 CCTTCCTTGGCCAGGCATGGTGG + Intergenic
1090234077 11:125133515-125133537 CCTTCCCTGGCTGGGCAGGATGG + Intergenic
1090444641 11:126753325-126753347 CCTTCCAGAACCAGACAGGAGGG + Intronic
1090966014 11:131598101-131598123 CCTGCCCTTTCCAGGCTGGAAGG + Intronic
1091296518 11:134477575-134477597 CCTTCCATTTCTAGGTAGTAGGG - Intergenic
1092273125 12:7038824-7038846 CCTGCCATGTTCAGGCGGGTCGG + Intronic
1097055009 12:56243918-56243940 CCTTCCACCTCCAGACAGGGTGG + Intronic
1104088083 12:125493848-125493870 GCATCCATTTCCAGGGAGGACGG - Intronic
1104088147 12:125494049-125494071 GCATCCATTTCCAGGGAGGAGGG - Intronic
1104088168 12:125494117-125494139 GCATCCATTTCCAGGGAGGAGGG - Intronic
1104088190 12:125494186-125494208 GCATCCATTTCCAGGGAGGAGGG - Intronic
1104088368 12:125494716-125494738 GCATCCATTTCCAGGGAGGAGGG - Intronic
1106406397 13:29478680-29478702 CATTCCATGTGTAGGCAGTAAGG - Intronic
1106921961 13:34573802-34573824 CCTTCCAAGCCCAGGAGGGAGGG + Intergenic
1107710358 13:43145100-43145122 CCATCTATGCTCAGGCAGGATGG - Intergenic
1112156494 13:96823045-96823067 CCTTCCTCTTCCAGCCAGGAGGG + Intronic
1112440874 13:99423816-99423838 CCTTCCAGGACCAGGCATGGTGG - Intergenic
1113920865 13:113908560-113908582 CTTTCGATGTACAGCCAGGAGGG + Intergenic
1113957437 13:114106776-114106798 CCTTCCATGTGCCTGGAGGATGG - Intronic
1115828841 14:37311269-37311291 ACTTCCATGTCTAGACAGCATGG - Intronic
1118608312 14:67519500-67519522 CCTTCCCTGTCCAAGAGGGAAGG - Intronic
1124958185 15:34373861-34373883 GGTTCCATGCCCAGGAAGGAAGG + Intergenic
1125979720 15:43989374-43989396 GATTCCATGCCCAGGAAGGAAGG + Intronic
1127275393 15:57439006-57439028 CCGTCCAGTTCCTGGCAGGAAGG - Exonic
1128355463 15:66923454-66923476 ACTCCCATGGCCAGGCAGAAGGG + Intergenic
1130307821 15:82726623-82726645 GATTCCATGCCCAGGAAGGAGGG + Intergenic
1132077515 15:98834747-98834769 CCTTCCATGTCCAGGGGCAAAGG - Intronic
1132574149 16:656996-657018 ACTTCCATGGCCAGGCTGGTTGG + Intronic
1133125300 16:3642341-3642363 CATCCCATGGCCTGGCAGGATGG - Intronic
1133246942 16:4455313-4455335 CCTGCGCTGTCCACGCAGGAGGG - Intronic
1133507356 16:6425217-6425239 ACTTCCATATGCAGACAGGAAGG + Intronic
1134134849 16:11671371-11671393 CCTTCCATCTCTGGGCAGGCTGG - Intronic
1134308736 16:13057128-13057150 CCCTCCAGCCCCAGGCAGGAAGG - Intronic
1134450624 16:14361107-14361129 CCTTCCAGGGCCAGGCACGGTGG + Intergenic
1134468034 16:14496106-14496128 CCTTCCATGGCCAGGCAAACAGG + Intronic
1134602700 16:15545939-15545961 CCTTCCATGGCCAGGAATGGTGG + Intronic
1135263520 16:21001357-21001379 CCTTCTATGTCTAGGCTGAAAGG + Intronic
1137521050 16:49195715-49195737 GCCTGTATGTCCAGGCAGGAAGG - Intergenic
1140988253 16:80180739-80180761 ACTTCCATTTCCAGGCAAGGTGG + Intergenic
1141424472 16:83936089-83936111 ACTTCCACGTCCTGGAAGGAGGG - Intronic
1141618136 16:85221736-85221758 TCCTTCATGTCCAGGCAGGTGGG + Intergenic
1142689831 17:1598830-1598852 CCTGCCCTGTCCAGGCCTGAGGG - Intronic
1142735559 17:1896563-1896585 CCTTCCCTGTCCAGACACGATGG - Intronic
1143269030 17:5662009-5662031 CCTCCCACACCCAGGCAGGAGGG + Intergenic
1144688439 17:17242552-17242574 CATTCCATGCCCAGGAAGGAAGG - Intergenic
1146658094 17:34646947-34646969 CCTTCCACGGCCAGGCCAGATGG - Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147949224 17:44097725-44097747 CCTTCCCTGGGCAGGCAGGCTGG - Intronic
1148262648 17:46196817-46196839 CATTCCATGGCCAGGCATGGTGG + Intronic
1149979982 17:61303021-61303043 CCTTCCATGGCCAGTCTGAAAGG - Intronic
1150229100 17:63540145-63540167 CCATCCATGGCCAGGCACGGTGG + Intronic
1151309700 17:73285701-73285723 CCTCCCCTGGCAAGGCAGGAAGG - Exonic
1151636501 17:75352537-75352559 CCTTCCATTTCCAGGGAGCGTGG - Intronic
1151763583 17:76121353-76121375 CCTCCCCTGTCGAGCCAGGAGGG - Intronic
1151957117 17:77385965-77385987 CATTCCATGTCCGGGCTGGAAGG + Intronic
1152300831 17:79494679-79494701 CCTCCCATGCCCAGGCAAGGAGG + Intronic
1152659701 17:81536560-81536582 CCTTCCCTGTCCAGGCCGGGCGG - Exonic
1152761002 17:82107022-82107044 CCCTGCATGTCTTGGCAGGAGGG + Intronic
1155162646 18:23208182-23208204 CCTTCCAACTCCAGGCAGAAAGG + Intronic
1156210342 18:34933328-34933350 TCTTACATGTACAGGCAGAAGGG + Intergenic
1158945358 18:62442794-62442816 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1160315761 18:77844903-77844925 CTTTCCATGTCCTGGAATGACGG + Intergenic
1160564904 18:79780971-79780993 CATTTCACGTCCAGGCAGGGAGG + Intergenic
1162246670 19:9407090-9407112 ACTTCCGTTTCCAGGCATGAGGG + Intergenic
1162259252 19:9518998-9519020 GATTCCATGTCCAGGAAGGAAGG - Intergenic
1162607176 19:11718320-11718342 CCTTCCCTGTCCAGGCACGGTGG - Intergenic
1163472800 19:17507035-17507057 TCTTCCATGTACAGGCCGGCTGG + Intergenic
1163690535 19:18736099-18736121 CCTCCCATGTCCACGCTGGCTGG - Intronic
1166730552 19:45056874-45056896 CCTCCCAACTCCAGGCAGTAGGG - Intronic
1167018557 19:46857867-46857889 CCTGGCATGTCCAGGCATGGCGG + Intergenic
1168031518 19:53683393-53683415 GATCCCAAGTCCAGGCAGGAAGG - Intergenic
1168523208 19:57068952-57068974 CACTCTGTGTCCAGGCAGGACGG + Intergenic
925656173 2:6151741-6151763 CTTTTCATGGCCAGGCAGGATGG - Intergenic
927047905 2:19298368-19298390 CCTTCATTCCCCAGGCAGGATGG + Intergenic
927139903 2:20122792-20122814 CCTCCCCGGTCCAGGCGGGATGG - Intergenic
928259948 2:29757457-29757479 CCTTTCATGTCCTGTAAGGAAGG + Intronic
929413534 2:41724044-41724066 CCTTCCATTTATAGGCAGGGAGG - Intergenic
930031315 2:47059640-47059662 CATTGCATGTCCAGGGAGAAGGG - Intronic
930604606 2:53480433-53480455 ACTTCCATGTCCAGTAAGGATGG + Intergenic
933143388 2:78821485-78821507 CCTTCCATAGCCAGTCAGAATGG + Intergenic
935622640 2:105143423-105143445 CCTCGCAGGCCCAGGCAGGATGG + Intergenic
935726752 2:106030406-106030428 CATGCCATGTACAGGAAGGATGG + Intergenic
935928692 2:108099158-108099180 GATTCCATGCCCAGGAAGGAAGG - Intergenic
936971576 2:118181451-118181473 ACGCCCATCTCCAGGCAGGATGG + Intergenic
937126137 2:119476176-119476198 CCCTTCATCTCCCGGCAGGAAGG - Intronic
937131101 2:119514220-119514242 CCTTTCATGTCTAGGCTGGGTGG + Intronic
937524425 2:122749645-122749667 CCTTCCATGAAAATGCAGGAAGG + Intergenic
937859993 2:126700188-126700210 CCATCTCTCTCCAGGCAGGATGG - Intergenic
938078757 2:128357861-128357883 GCTTCCATGCCCAGGCAGCCCGG - Intergenic
938713797 2:134000400-134000422 CCTGCCATGTCCAGCCTGGATGG + Intergenic
941411942 2:165168740-165168762 CATTCTTTGTCCAGTCAGGAGGG + Exonic
942143642 2:173003250-173003272 CGTTCCATGCCCAGGTAGGGAGG + Intronic
944690441 2:202153844-202153866 TCATCCAGGGCCAGGCAGGAAGG + Intronic
947471417 2:230404527-230404549 CCTTCCAGCTCCAGGTATGAGGG - Intergenic
948208171 2:236173637-236173659 CCTTCCAGGACGAGGCAGGCGGG - Intergenic
948648616 2:239424858-239424880 CCCTTGGTGTCCAGGCAGGAAGG - Intergenic
948777768 2:240298689-240298711 CATTCCAAGTCAAGTCAGGATGG + Intergenic
1171125795 20:22601009-22601031 CCTCCCAAGTCCAAGCAAGATGG - Intergenic
1171824185 20:29879153-29879175 CCCCACATGTCCAGGCAGGTTGG + Intergenic
1172548761 20:35782588-35782610 CTTTTCATGTCCAGGCTGCATGG + Intronic
1173579146 20:44133634-44133656 CCTTCTATGTCAGGGCAGGATGG + Intronic
1173655664 20:44698715-44698737 CCTTCCATGTCCAGGCTGGGAGG + Intergenic
1173713234 20:45178838-45178860 CCTTTCATGTTCAGTCAGGCAGG + Intergenic
1174662931 20:52230418-52230440 ACCTCCATCCCCAGGCAGGAGGG - Intergenic
1174867582 20:54152209-54152231 CTTTACATGTCCAGGCAAAATGG - Intergenic
1175100419 20:56575244-56575266 ACTTCCATGTCCTCGCGGGATGG + Intergenic
1175261041 20:57674271-57674293 CCTTCCATGTGCTGGCACCAAGG + Intronic
1175380299 20:58558130-58558152 CCCTCCATGTCCTGGCACGGAGG + Intergenic
1175464794 20:59183258-59183280 GCTGGCAAGTCCAGGCAGGAGGG - Intergenic
1175899899 20:62355805-62355827 CCTTCCCTGTCCAGGCACAGGGG - Intronic
1176089641 20:63313145-63313167 CCTCCCTAGGCCAGGCAGGACGG - Exonic
1177249745 21:18577346-18577368 CATTCCATATCCAGAAAGGAAGG - Intergenic
1179192020 21:39131423-39131445 ACTTTCAAGTCCAGGCAGGTTGG + Intergenic
1179909510 21:44440623-44440645 CCTTGCAGGCCCAGGCAGGCTGG + Intronic
1179930685 21:44569022-44569044 CCTGCCACGTGCAGGCAGGCGGG - Intronic
1179995638 21:44972808-44972830 CCTGCCCTGGCCAGGCAGGTGGG + Intronic
1180994779 22:19959989-19960011 CCTTCCTTTGCCTGGCAGGAGGG - Intronic
1181044129 22:20206696-20206718 CCTCCCAACTCCAGCCAGGAGGG - Intergenic
1181485668 22:23230290-23230312 ACTTCCAATTCCAGGCAAGATGG - Intronic
1181727298 22:24820332-24820354 CCTTCCAGGTCATGGCAGGTTGG + Intronic
1182298554 22:29325467-29325489 ACATCCCTGCCCAGGCAGGAGGG + Intergenic
1183050251 22:35255208-35255230 CCTTCCAGGGCCAGGCATGGTGG + Intergenic
1183406087 22:37631353-37631375 CCTTCCATCCCCAGGAAGGCAGG + Intronic
1183486410 22:38089517-38089539 CTCACCATGTCCAGGCAGGTGGG + Exonic
1183719557 22:39554516-39554538 CCTACCATGTCCTGGGAGTAGGG - Intergenic
1183910327 22:41074477-41074499 GATTCCATGCCCAGGAAGGAAGG + Intergenic
1183949641 22:41345731-41345753 CCTGCCAAGTCCTGGCAGCAGGG + Intronic
1184731456 22:46373271-46373293 CTTTCTGTGTCCAGGCAGGCAGG - Intronic
1185266944 22:49909217-49909239 CCTTCAGTGTCCGTGCAGGAGGG - Intronic
949875270 3:8622580-8622602 CCTACCAGGGCCAGGCAGTAAGG - Intronic
949925504 3:9037844-9037866 CCTTCCATCGCCAGCCTGGAGGG + Intronic
950507210 3:13402606-13402628 CCTTTCATGTCCATGTAGCAGGG + Intronic
950636991 3:14322525-14322547 TCTTCCATGGCCAGGGAGGGTGG + Intergenic
950664642 3:14487919-14487941 CCCTCCATGTTCAGGGATGAGGG + Exonic
953043316 3:39273915-39273937 GCTTCCTTGGCCAGGCATGATGG - Intronic
953664532 3:44916488-44916510 CCTTCCAGCTCCAGGCAAAAGGG - Intronic
953907397 3:46875153-46875175 CCTTCCATTTCCAGGGACCACGG + Intronic
954606924 3:51918964-51918986 ACTTCCATTTCCAGCCAAGATGG + Intergenic
955241766 3:57184729-57184751 CTTCCCATGTCAAGGCGGGATGG - Intergenic
955435947 3:58899241-58899263 CCTTCCTTGTCCAGGCTGTCTGG + Intronic
957611357 3:82471612-82471634 CCTTCCCTTTCCATCCAGGATGG + Intergenic
960713265 3:120552205-120552227 CATTCCATGGCCTGGCATGATGG + Intergenic
961143449 3:124574812-124574834 CCTTCCCTGAGCAGACAGGATGG - Intronic
962703643 3:138022844-138022866 CATCCCATGGCCAGTCAGGAGGG + Intronic
963064877 3:141255771-141255793 CTTTCCATCTCCAGGTAGGTAGG - Intronic
964205693 3:154172405-154172427 CCTGCCATGGCCAGGCACCATGG + Intronic
964395473 3:156241087-156241109 CCTGCCATGTGCAGGCAGCGTGG + Intronic
965771263 3:172183774-172183796 CCTTCCATTTCCAGAGTGGAAGG - Intronic
967268518 3:187713615-187713637 CCTTCCATGTCCAATCAGATTGG - Intronic
968657422 4:1784745-1784767 TTTTCCATGCCCAGGCAGGCGGG + Intergenic
969653851 4:8484805-8484827 CCAACCATGCCCAGGAAGGAAGG + Intronic
973262388 4:48178091-48178113 CCTTCCATAGCCAGGCATGAAGG - Intronic
973812112 4:54581571-54581593 CCTTTCATGGCCAGGCACGGTGG + Intergenic
975931279 4:79526169-79526191 CCCTCCATGTCCATGAAGGATGG + Intergenic
978496780 4:109368049-109368071 CCCTCCATAGCCAGGTAGGAAGG - Intergenic
978751935 4:112259642-112259664 TCTTCCATGTGAAGGAAGGAAGG - Intronic
981291522 4:143082166-143082188 CCTTCCATCTACATTCAGGAGGG + Intergenic
981889488 4:149718080-149718102 CCTTCCAGTTGTAGGCAGGAGGG - Intergenic
984174166 4:176395807-176395829 CTTTCCACTTCCAGGCATGATGG - Intergenic
985627433 5:996741-996763 CCTTCAAGGACCAGGCAGAAGGG + Intergenic
985658838 5:1145541-1145563 CTTTCCAGGACCAGCCAGGAAGG + Intergenic
986351392 5:6883152-6883174 CTTTCCAAGTCCAGGGTGGAGGG - Intergenic
986571443 5:9170179-9170201 CCTTCCATGTCCAGCCTGGTAGG + Intronic
988100039 5:26663461-26663483 CCTACTATGTTCAGGCAGAATGG + Intergenic
990411043 5:55541814-55541836 CCTTCCGTGTCAAGGTTGGAGGG + Intergenic
990988215 5:61660642-61660664 CCCTCCATGGCCAGAGAGGAAGG + Intronic
992944794 5:81799572-81799594 CCTTCCCTGTTCCAGCAGGAAGG + Intergenic
994316528 5:98339526-98339548 GATTCCATGCCCAGGAAGGAAGG - Intergenic
995824464 5:116279176-116279198 CACTGCATGTCCAGGCAGTACGG - Intronic
995874220 5:116773709-116773731 CCTTCCAAGACCAGGTGGGAAGG - Intergenic
997821547 5:137070570-137070592 CCTTCCTTGTGCAGGCAGATTGG - Intronic
998153101 5:139768433-139768455 CCTTCCTTGGCCAGGCATGGTGG + Intergenic
999751777 5:154632856-154632878 TCTACCATGTCCAGCCAGAATGG + Intergenic
999959688 5:156741408-156741430 ACTTCCAAGTACAGCCAGGAAGG + Intronic
1000173106 5:158723231-158723253 CCTTCCCTAACCAGGCTGGAAGG + Intronic
1001251021 5:170147010-170147032 CCTGCTATGTCCAGGCACCATGG + Intergenic
1001545918 5:172570495-172570517 CCTGTCATGTCCAGGGAGGCAGG + Intergenic
1002162135 5:177320630-177320652 CCTTCCATGGCCGGGCATGGTGG + Intergenic
1002305136 5:178278693-178278715 CCTTCACTGTGCAGGAAGGATGG - Intronic
1003559836 6:7171325-7171347 CCGTCCCCGTCAAGGCAGGAAGG - Intronic
1003755901 6:9119765-9119787 CCTGCCATGTACTGACAGGAAGG + Intergenic
1006357449 6:33568266-33568288 CCTTCCTTTTCCTGGCAAGAGGG - Intergenic
1006646159 6:35515692-35515714 CCTTCCTTGGCCAGGCACGGTGG - Intergenic
1007198049 6:40080054-40080076 CCCTCCATGCCTATGCAGGAAGG - Intergenic
1007705200 6:43786689-43786711 CCTTCTATATCAAGACAGGATGG - Intergenic
1007719828 6:43878389-43878411 TCTTCCCTCCCCAGGCAGGACGG + Intergenic
1007985792 6:46205764-46205786 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1008220338 6:48846359-48846381 CCTTCCATGACCAGTCAGACTGG - Intergenic
1008976938 6:57437942-57437964 TCTTTCCTGTCCAGGCAGGGTGG - Intronic
1009273733 6:61648684-61648706 CCTTCCCTCCCCAGTCAGGATGG - Intergenic
1016331337 6:142955056-142955078 CCTTCCATGTCCAGCCACACTGG - Intergenic
1017453356 6:154575213-154575235 CCTTGCATTTCCAGGCAGCGAGG + Intergenic
1017657754 6:156646087-156646109 GCTTCCCTGATCAGGCAGGAGGG + Intergenic
1018222691 6:161596868-161596890 CCTTCCATGTCTCGGCAGCAGGG + Intronic
1018472635 6:164110167-164110189 TCTTCAATGTCCAGGCTGGAAGG - Intergenic
1019064995 6:169288978-169289000 CCTTTCATCTCCATCCAGGACGG + Intergenic
1019803810 7:3107842-3107864 CCTCTCATCCCCAGGCAGGAAGG - Intergenic
1020878429 7:13727877-13727899 CCTGCCATATGCAGGCAGGCTGG - Intergenic
1021266757 7:18534265-18534287 CCTTGCATGTGCAGGCGTGATGG + Intronic
1022508655 7:30921965-30921987 CCTCCCAGGCCCAGGCATGAAGG - Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1022555306 7:31288502-31288524 AATTCCATTTCCAGCCAGGATGG - Intergenic
1023880360 7:44316088-44316110 CTTTCCATTTCTAGGCAGCACGG - Intronic
1024000227 7:45184810-45184832 CCTTCAATGCCCAGGCAGGCAGG + Intronic
1024712740 7:52035389-52035411 TCTGCCATCTGCAGGCAGGAGGG - Intergenic
1026569934 7:71520672-71520694 GATTCCAGGGCCAGGCAGGATGG - Intronic
1027579816 7:79978274-79978296 CCTGCAAAGTCCAGGCAGGAAGG + Intergenic
1028404552 7:90461423-90461445 CCTTCCTTCTCTGGGCAGGATGG + Intronic
1029406315 7:100375976-100375998 TCTCCCAGGCCCAGGCAGGAAGG + Intronic
1029475937 7:100784676-100784698 CCATCCAGGTCCCAGCAGGAGGG - Exonic
1029673318 7:102048985-102049007 CCTTCTAAGTCCAGCCAGGTGGG + Intronic
1030554566 7:111007281-111007303 CCTGACATGTCCAGGAAGGAAGG - Intronic
1032468185 7:132159801-132159823 CCTTTCCTGTCCAGGCAAGCAGG + Intronic
1032537997 7:132680509-132680531 CCACCGTTGTCCAGGCAGGAAGG - Intronic
1035377527 7:158415349-158415371 CCTTCCAAACCCAGGCAGCAAGG - Intronic
1035466114 7:159079028-159079050 CCTTCAGTGTCCATGGAGGAAGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038428780 8:27483297-27483319 CCCTACATGTCCTGGCAGGTGGG - Intergenic
1039659143 8:39444572-39444594 CCTTCCATGCTCAGCAAGGAAGG + Intergenic
1039981969 8:42415560-42415582 CCACCCCTGTCCAGGGAGGAGGG - Intergenic
1041643722 8:60229796-60229818 CACACCATGTCTAGGCAGGAGGG - Intronic
1041802498 8:61815034-61815056 CTTTCCATGTCCAGTCTGGATGG + Intergenic
1047218172 8:122896076-122896098 CATTCCAGCTTCAGGCAGGATGG - Intronic
1048373470 8:133801163-133801185 CCTTCCAGGGGCAGGCAGAATGG - Intergenic
1049271087 8:141696654-141696676 GGCTCCATGTCCAGGCTGGAAGG - Intergenic
1049280565 8:141741997-141742019 ACTCAGATGTCCAGGCAGGAAGG + Intergenic
1051812898 9:21070413-21070435 CCTTCCATCCCCATGCAGAAGGG - Intergenic
1053069779 9:35094355-35094377 TCTTTCATGTCCCTGCAGGAAGG - Exonic
1055818281 9:80232482-80232504 CAATCTATGTCCAGGCAGCAGGG + Intergenic
1056148453 9:83759292-83759314 GCTTCAATGCCCAGGCTGGAAGG + Intronic
1056502174 9:87220810-87220832 CCTTCCATATGCATGCATGATGG - Intergenic
1056731498 9:89169977-89169999 CCATCCCTGACCTGGCAGGAGGG - Intronic
1057277879 9:93685891-93685913 CTTTCCCTGTTCAGGGAGGAGGG + Intergenic
1057793722 9:98141253-98141275 CCTGCCCTGTCCTGGCAGGGCGG + Intronic
1058084288 9:100732021-100732043 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1059343500 9:113612914-113612936 CCTTCTGTCCCCAGGCAGGAAGG - Intergenic
1060200650 9:121650285-121650307 CCTTCCCTGACCAGGGGGGAGGG - Intronic
1060403213 9:123360397-123360419 CCTTCCCGGGCCAGGCTGGAGGG - Intronic
1060524767 9:124314233-124314255 ACTGCCATGTACAAGCAGGAGGG - Intronic
1061858124 9:133454287-133454309 GCTTCCGTGGCCAGGCAAGATGG - Intronic
1061925693 9:133805082-133805104 CCCTCCCTGTCCAGGCAGCCGGG - Intronic
1062098870 9:134717613-134717635 CCTCCCCTGTCCTGGCAGGCGGG - Intronic
1062627056 9:137448111-137448133 CCAACTCTGTCCAGGCAGGAAGG + Exonic
1062692185 9:137847805-137847827 CCAACCATGCCCAGGAAGGAAGG - Intronic
1185538662 X:884455-884477 CCTTCAATTTGAAGGCAGGATGG - Intergenic
1186460989 X:9748565-9748587 CCTTCCGTGTCCAGGTAAGTTGG - Exonic
1189471341 X:41316694-41316716 ATTTCCATGCCCAGGAAGGAAGG + Intergenic
1189957242 X:46288327-46288349 GATTCCATGCCCAGGAAGGAAGG + Intergenic
1190427343 X:50345639-50345661 CCTACCAAGTCCATGGAGGAGGG + Intronic
1192656760 X:73001858-73001880 TCCACCATGTCAAGGCAGGAAGG - Intergenic
1192665360 X:73081143-73081165 TCCACCATGTCAAGGCAGGAAGG + Intergenic
1192799483 X:74452124-74452146 CCATGCATGTCCAGTCTGGAGGG - Intronic
1196193566 X:112818282-112818304 CTTTCAGTCTCCAGGCAGGAGGG - Intronic
1196864589 X:120059328-120059350 CCTTCCCTGTTCAGGCAGAGGGG - Intergenic
1196878512 X:120177003-120177025 CCTTCCCTGTTCAGGCAGAGGGG + Intergenic
1200115694 X:153768822-153768844 CCCTCGATGGCCCGGCAGGAAGG + Intronic
1201856697 Y:18552475-18552497 CCTTCCACTTCTAGCCAGGAAGG + Intronic
1201876624 Y:18767905-18767927 CCTTCCACTTCTAGCCAGGAAGG - Intronic
1202168941 Y:22020541-22020563 ACTTCCTAGTCCAGGAAGGAAGG + Intergenic
1202180107 Y:22132525-22132547 CCTACAATGTCTAGGCAGGCTGG + Intergenic
1202211253 Y:22453874-22453896 CCTACAATGTCTAGGCAGGCTGG - Intergenic
1202222420 Y:22565827-22565849 ACTTCCTAGTCCAGGAAGGAAGG - Intergenic
1202320695 Y:23629833-23629855 ACTTCCTAGTCCAGGAAGGAAGG + Intergenic
1202550072 Y:26040223-26040245 ACTTCCTAGTCCAGGAAGGAAGG - Intergenic