ID: 1088587097

View in Genome Browser
Species Human (GRCh38)
Location 11:111368920-111368942
Sequence CTCCGATGACAGATGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088587097 Original CRISPR CTCCGATGACAGATGGGCCA TGG (reversed) Intronic
902406795 1:16188724-16188746 CTCCCAGGACAGACTGGCCAAGG - Intergenic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
908693584 1:66810978-66811000 CTTTGATGACAGAAGGGCCTTGG - Intergenic
912469707 1:109898091-109898113 GGCCGATGACAGGTGAGCCAAGG - Intergenic
917439161 1:175051549-175051571 CTTCGATGATATCTGGGCCAGGG - Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918566070 1:185933705-185933727 CTCCAATGACAGATTAGCCAAGG - Exonic
923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG + Exonic
1070673706 10:78397352-78397374 CCACGAAGTCAGATGGGCCATGG + Intergenic
1073638878 10:105229702-105229724 CTGGGATGTCAGGTGGGCCAGGG + Intronic
1074429442 10:113381269-113381291 CTCCTCTGACAGGTGAGCCAAGG + Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG + Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG + Intronic
1091695898 12:2627861-2627883 CTCCTAGGACACATGGGTCACGG - Intronic
1092067008 12:5599057-5599079 ATCCGATGACACTTGGGTCAAGG - Intronic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1107627207 13:42301148-42301170 ATCAGATGACAGATGAGCCTTGG - Exonic
1113074493 13:106454547-106454569 CACCCCAGACAGATGGGCCATGG - Intergenic
1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG + Intergenic
1121945849 14:98121056-98121078 CACTGCTGACAGATGAGCCAAGG - Intergenic
1122119528 14:99544690-99544712 CTCGGAGGAGAGATGGGTCAAGG - Intronic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1139375098 16:66491947-66491969 CTCCGAGGAAAGATGAACCAAGG + Intronic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG + Intergenic
1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150276185 17:63899300-63899322 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG + Intronic
1152330065 17:79667643-79667665 AAACGAAGACAGATGGGCCATGG + Intergenic
1153438710 18:5093419-5093441 GTGCTATGACAGATGGGCCCAGG - Intergenic
1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG + Exonic
1161550183 19:4908563-4908585 CTCCAAGGACAGATGGGTCTAGG - Intronic
1161784775 19:6317410-6317432 GTCCAAGGACAGATGGGACAGGG + Intronic
1163114623 19:15181435-15181457 CTCTGATGACTGATGGGGCAGGG - Intronic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
930449679 2:51519403-51519425 CTGAGATCACAGATGGGCTAAGG + Intergenic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
938260609 2:129892661-129892683 CTCCTGTGACAAAGGGGCCAAGG - Intergenic
938493196 2:131776558-131776580 CTCTGATGCCTGATGGGTCAGGG + Intergenic
938499286 2:131822095-131822117 CTCTGATGCCTGATGGGTCAGGG - Intergenic
941688999 2:168478748-168478770 CACCCAAGACAGAAGGGCCAGGG - Intronic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG + Intronic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1174188323 20:48722641-48722663 CTCTGAGGAGAGATGGGCCCTGG - Intronic
1175768238 20:61606042-61606064 CTCTGAGGACACATGGGCCCAGG + Intronic
1175954102 20:62599513-62599535 CTCCCATGACAGAGGAGCCTGGG - Intergenic
1176062028 20:63176647-63176669 CTCCGAGGGCAGATGGCGCAGGG + Intergenic
1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG + Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1185003355 22:48260187-48260209 CCCCTATGGCAGATGGTCCATGG - Intergenic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954869917 3:53760031-53760053 GTCTGCTGATAGATGGGCCAGGG + Intronic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969981928 4:11166512-11166534 CTCCCATTAAAGATGGGGCAGGG - Intergenic
986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG + Intergenic
987117958 5:14741336-14741358 CTCAGCAGACAGATGGGCCTGGG + Intronic
990219989 5:53577391-53577413 CTGAAATGACACATGGGCCAAGG + Intronic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
1001448612 5:171806857-171806879 CTCCGATGACAGAGCACCCACGG - Intergenic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1004854045 6:19731323-19731345 TCCAGATGACAGTTGGGCCAGGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007467632 6:42065713-42065735 CTCCCATGACAGATGGTCTCGGG - Intronic
1009381132 6:63031507-63031529 ATCCGCTGACAGCTGGACCATGG - Intergenic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1025982941 7:66422267-66422289 CTTTCATGGCAGATGGGCCAAGG - Intergenic
1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG + Intronic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1033737191 7:144234177-144234199 CTCCAATGACAGCTGGACCAGGG - Intergenic
1033745866 7:144316769-144316791 CTCCAATGACAGCTGGACCAGGG + Intergenic
1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG + Intronic
1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG + Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1052234310 9:26191619-26191641 CTCATATGACAAAAGGGCCAGGG + Intergenic
1060230161 9:121820072-121820094 CTCCCGGGACAGAGGGGCCATGG + Intergenic
1060303649 9:122391700-122391722 CTCCCATGACAAATGGTCCCCGG + Intronic
1190688538 X:52894976-52894998 CTCCTATTACAGATGAGGCACGG - Intronic
1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG + Intronic
1198036735 X:132808416-132808438 CTCCCATGACACATGGGGCTGGG - Intronic