ID: 1088588386

View in Genome Browser
Species Human (GRCh38)
Location 11:111379627-111379649
Sequence CGGCGCCCATGCAGGCTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088588383_1088588386 2 Left 1088588383 11:111379602-111379624 CCTCTGGAAAACGTTGATCTTTG 0: 1
1: 0
2: 2
3: 12
4: 247
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588382_1088588386 11 Left 1088588382 11:111379593-111379615 CCAAAAGCTCCTCTGGAAAACGT 0: 1
1: 0
2: 2
3: 8
4: 136
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588377_1088588386 29 Left 1088588377 11:111379575-111379597 CCCAGGCCAGTGATGAGCCCAAA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588378_1088588386 28 Left 1088588378 11:111379576-111379598 CCAGGCCAGTGATGAGCCCAAAA 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588376_1088588386 30 Left 1088588376 11:111379574-111379596 CCCCAGGCCAGTGATGAGCCCAA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588379_1088588386 23 Left 1088588379 11:111379581-111379603 CCAGTGATGAGCCCAAAAGCTCC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1088588381_1088588386 12 Left 1088588381 11:111379592-111379614 CCCAAAAGCTCCTCTGGAAAACG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088588386 Original CRISPR CGGCGCCCATGCAGGCTTCC AGG Exonic
901074924 1:6548090-6548112 CGTGGCCCAGGCAGGCTTCGAGG + Intronic
901773355 1:11542538-11542560 GGGCACCAATGAAGGCTTCCTGG - Intergenic
902773825 1:18661685-18661707 TGGAGCCCATGCTGGCTTTCTGG + Intronic
902807759 1:18871674-18871696 GGGGTCCCATGCAGGCATCCTGG + Exonic
903224070 1:21885108-21885130 GGGAGTCCATCCAGGCTTCCCGG - Exonic
907296544 1:53459668-53459690 AGGGGCCCAAGCAGGCCTCCGGG + Exonic
908569920 1:65398705-65398727 CTGGGGCCATGCAGGCTTCAGGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1071264099 10:83948754-83948776 TGGCGCCCCTCAAGGCTTCCAGG + Intergenic
1075728364 10:124622221-124622243 AGGGGCCCCTGCAGGATTCCAGG - Exonic
1077293899 11:1815122-1815144 AAGAGCCCATTCAGGCTTCCTGG - Intergenic
1077351003 11:2093150-2093172 CGGCTCCCATCCAGCCTGCCAGG - Intergenic
1079102752 11:17551929-17551951 GGGTTCCCAGGCAGGCTTCCTGG - Intronic
1083587256 11:63869328-63869350 CGGCGAGTCTGCAGGCTTCCAGG - Intronic
1084006167 11:66324788-66324810 CGCCCCCCAGGCAGGCGTCCTGG + Intergenic
1084314626 11:68337913-68337935 GGTGGCCCAGGCAGGCTTCCTGG - Intronic
1086954047 11:92917283-92917305 AGGGGCCCATGCAGGAGTCCTGG + Intergenic
1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG + Exonic
1089499060 11:118922241-118922263 CGGCGGCCCTGAAGGCTGCCTGG - Intronic
1090652828 11:128822638-128822660 AGGCATTCATGCAGGCTTCCTGG + Intergenic
1090713011 11:129404752-129404774 AGGTGCCCTTGCAAGCTTCCTGG + Intronic
1091697077 12:2634962-2634984 AGCAGCCCATGCAGGCATCCAGG + Intronic
1092820560 12:12350096-12350118 CGGCGCCCCTGCTGCCATCCAGG + Exonic
1094470123 12:30795612-30795634 CTGCGCCCCTGCAGGCCTCGCGG + Intergenic
1102783584 12:115585741-115585763 TGGGGCCCATGCTGGCTTCAGGG - Intergenic
1103649584 12:122422454-122422476 CTGCTCCCCTGCCGGCTTCCCGG - Intronic
1117524047 14:56579800-56579822 CGGCGGCCACGGCGGCTTCCGGG - Exonic
1119383145 14:74241041-74241063 CGGGGCGCCCGCAGGCTTCCTGG + Intronic
1124202807 15:27693000-27693022 GGGCACACATGCAGGCTTTCAGG - Intergenic
1124252896 15:28118711-28118733 AGGCGCCTGTGCAGCCTTCCTGG + Intronic
1125192937 15:37014630-37014652 CGGCACTCAGGCAGGTTTCCTGG + Intronic
1128924201 15:71639288-71639310 CAGCCCCCATGCAAGCTACCAGG - Intronic
1129325987 15:74800543-74800565 CTCCTCCCACGCAGGCTTCCTGG + Intronic
1132975721 16:2710195-2710217 CTGCCCCCACGCTGGCTTCCTGG - Intergenic
1135237773 16:20774762-20774784 CAGTGCCCATGCACACTTCCTGG - Intronic
1137613862 16:49835714-49835736 CACCTCCTATGCAGGCTTCCTGG - Intronic
1138550401 16:57744586-57744608 CGTAGTCCAGGCAGGCTTCCTGG - Intronic
1140759588 16:78099260-78099282 CGGCGCCCATGCTGTTGTCCTGG - Intergenic
1141426497 16:83947717-83947739 CGGCCCCCCTGCAGGCTGTCTGG - Intronic
1141631127 16:85288701-85288723 TGGGGTCCAGGCAGGCTTCCTGG + Intergenic
1143991549 17:10967812-10967834 TGGGGCCCATGCAGCCTTCAAGG - Intergenic
1148087709 17:45004420-45004442 CGAAGCCCAGGCAGACTTCCTGG - Intergenic
1148577811 17:48723650-48723672 CGGCGGCCTCGCAGGGTTCCCGG + Intronic
1148681480 17:49476387-49476409 GGCAGCCCAGGCAGGCTTCCTGG - Intronic
1152496533 17:80676708-80676730 CAGCCACCACGCAGGCTTCCAGG - Intronic
1161253372 19:3293344-3293366 CAGCGCCCAGGCAGCCATCCAGG + Exonic
1162738198 19:12758124-12758146 CGGCACCCACGCAGGTGTCCCGG + Exonic
1163019651 19:14475386-14475408 CGCCGCCCTTGCTGGCCTCCAGG + Intergenic
1163821021 19:19496608-19496630 CGGAGCCCATGCCGCCCTCCCGG + Intronic
1165321497 19:35088227-35088249 CTGCCCCCATTCAGGCTTACGGG - Intergenic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1168714579 19:58519437-58519459 CGGCGCCCAGGCCAGCTTCCCGG + Intronic
924998204 2:383327-383349 GCTCGCCCCTGCAGGCTTCCCGG - Intergenic
929812338 2:45201064-45201086 CAGTGCCCAAGCATGCTTCCTGG + Intergenic
936600418 2:113889952-113889974 CGGCGGCCATCTTGGCTTCCCGG + Exonic
937863316 2:126730238-126730260 TGGCCCCCATGCAGGGTTCTGGG - Intergenic
940771143 2:157840717-157840739 CTGCCCCCATGCTGGCTTCCTGG - Intronic
942653984 2:178195264-178195286 TGGCGCCCCTGCAGCCCTCCCGG + Intronic
948892297 2:240913345-240913367 TGGCGCCCACGCAGGCTTCCTGG - Intergenic
1169291709 20:4358765-4358787 CGGTTCTCATGCAGCCTTCCCGG - Intergenic
1171385761 20:24768445-24768467 CAGTGCAAATGCAGGCTTCCTGG - Intergenic
1172189242 20:33051981-33052003 TGGGGCTCATGAAGGCTTCCTGG + Intergenic
1173724673 20:45289052-45289074 TGGAGCCCAGGAAGGCTTCCTGG - Intergenic
1174214823 20:48908322-48908344 CAGCCCCCGTGCAGGTTTCCTGG - Intergenic
1175404123 20:58716119-58716141 CGGCCTCCGTGCAGGCTGCCGGG - Intronic
1175913775 20:62416353-62416375 CGGCGCCCCTGCTGCCTGCCAGG - Intronic
1175989111 20:62778777-62778799 CTGCCCAAATGCAGGCTTCCAGG - Intergenic
1181032046 22:20152998-20153020 AGGGGACCCTGCAGGCTTCCGGG - Intergenic
1181511496 22:23391185-23391207 AGGGGACCCTGCAGGCTTCCAGG + Intergenic
1182059126 22:27384385-27384407 CGGCACCCCTGCATACTTCCTGG + Intergenic
1183634432 22:39052444-39052466 CGCCATCCCTGCAGGCTTCCCGG - Intronic
1184673077 22:46025858-46025880 CGCCTCCCAGGAAGGCTTCCTGG + Intergenic
1184901429 22:47448780-47448802 GGGCACCCATGCAGGGATCCAGG + Intergenic
1184977999 22:48076726-48076748 CGGGCCCCACGCAGGATTCCTGG + Intergenic
1185042469 22:48512163-48512185 CTGAGCCCCTGCAGGCTGCCTGG + Intronic
950611418 3:14129456-14129478 CAGCTCCCAGCCAGGCTTCCTGG + Exonic
954325422 3:49860844-49860866 CTTCCCCCATGCAGGCTTTCAGG - Exonic
954713735 3:52517072-52517094 CGTCGCCCATGTAGCCATCCTGG - Exonic
969035298 4:4248523-4248545 CGAAGCCCTCGCAGGCTTCCGGG + Intergenic
969307298 4:6333199-6333221 CAGCTCCGATGCAGGCTCCCAGG + Intronic
969441834 4:7221757-7221779 GGAGGCCCAGGCAGGCTTCCTGG + Intronic
969589566 4:8114125-8114147 CCCCGCCCATGAGGGCTTCCAGG - Intronic
969725655 4:8916674-8916696 CTCTCCCCATGCAGGCTTCCTGG + Intergenic
972404194 4:38731054-38731076 TGGGGCCTATACAGGCTTCCTGG + Intergenic
987657611 5:20826740-20826762 ATGCGACCATGCTGGCTTCCTGG - Intergenic
988765928 5:34377214-34377236 ACGCGACCATGCTGGCTTCCTGG + Intergenic
990862381 5:60341283-60341305 CAGAGCCCAGGCAGGCATCCAGG + Intronic
992559305 5:77934506-77934528 CAGCCCCTATTCAGGCTTCCAGG - Intergenic
998462153 5:142317762-142317784 CTGCTCCCATCCTGGCTTCCTGG - Intronic
1002067523 5:176659548-176659570 TGGAGCCCACGCTGGCTTCCAGG - Intergenic
1003030579 6:2597128-2597150 GGGCCCCCATGCAGGCTGGCAGG - Intergenic
1003427695 6:6008656-6008678 AGACTCCCATGCAGCCTTCCTGG + Intergenic
1006225776 6:32535238-32535260 CCCTGCCCCTGCAGGCTTCCAGG + Intergenic
1007341738 6:41194915-41194937 AGGCCCCCATCCAGGCTTCCAGG - Intronic
1007567989 6:42867593-42867615 CAGCCCACATGAAGGCTTCCAGG - Exonic
1017643561 6:156517564-156517586 CGGCTCACATGCAGTCTTTCGGG + Intergenic
1018343677 6:162879772-162879794 GGGTGCCCAAGCAGCCTTCCAGG + Intronic
1018834977 6:167476198-167476220 AGGGGCACAGGCAGGCTTCCAGG - Intergenic
1026894578 7:74002849-74002871 CAGCGCCCAGGCCGGCGTCCGGG - Intergenic
1026905369 7:74060080-74060102 CGGGGCCCATGGAGGCTTCGGGG - Intronic
1028121372 7:87059539-87059561 CGGCGGCAAGGCAGCCTTCCCGG + Exonic
1034870529 7:154679423-154679445 CGGACCGGATGCAGGCTTCCTGG - Intronic
1037815078 8:22107840-22107862 CGGAGTCCCTGCAGGCTGCCTGG - Exonic
1047970640 8:130081378-130081400 GGGTGCCCATGCAGGGTCCCGGG - Intronic
1050892075 9:10836378-10836400 CGGCCCCCGTGCAGGATCCCTGG + Intergenic
1054769478 9:69070256-69070278 CGGCGGCCCTCCAGCCTTCCTGG - Intronic
1057182332 9:93036840-93036862 CGGAGCCCCTGCTGGCTACCTGG + Intergenic
1057550691 9:96049380-96049402 CGGAGCCCAGCCAGGCCTCCGGG + Intergenic
1061858043 9:133453920-133453942 CAGCTCCCTTGCAGGCTGCCTGG + Intronic
1062273391 9:135719846-135719868 CGGCCCCAGTGCAGGCCTCCCGG + Intronic
1062511920 9:136910971-136910993 CGGGCCCCAGGCAGGCGTCCTGG - Intronic
1190482437 X:50890282-50890304 CAGTGCCCATGCATGCCTCCTGG + Intergenic
1198951856 X:142080875-142080897 CAGCTCCCATGTATGCTTCCTGG - Intergenic
1200065246 X:153501698-153501720 CGGGGGCCGGGCAGGCTTCCCGG - Intronic
1200169176 X:154059870-154059892 CAGCTCCCAGGCAGGCTTCAGGG - Intronic