ID: 1088589034

View in Genome Browser
Species Human (GRCh38)
Location 11:111386590-111386612
Sequence GTGTATATACATATTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088589031_1088589034 12 Left 1088589031 11:111386555-111386577 CCAGGGTGATTTTAAAGGAGGGC 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG 0: 1
1: 0
2: 5
3: 37
4: 453
1088589032_1088589034 -10 Left 1088589032 11:111386577-111386599 CCATGAATCCTGTGTGTATATAC 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG 0: 1
1: 0
2: 5
3: 37
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088589034 Original CRISPR GTGTATATACATATTTTCCT TGG Intronic
903394919 1:22993044-22993066 CTATATATACATATTTTAATTGG - Intergenic
903602846 1:24555058-24555080 ATGTATATATATATTTTGGTAGG - Intergenic
905110223 1:35589369-35589391 GTGTCTGTACATGTGTTCCTGGG + Intronic
905235572 1:36543771-36543793 GTCTATGTACATGTTTTCCTGGG + Intergenic
905253897 1:36667589-36667611 ACGTGTATGCATATTTTCCTAGG + Intergenic
905868517 1:41389771-41389793 GTGTGTATGCACACTTTCCTAGG - Intergenic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
907226579 1:52952819-52952841 GTATATATATATATTTTCTGTGG + Intronic
907265543 1:53258095-53258117 GTATATGTGCATTTTTTCCTTGG + Intronic
907355053 1:53865610-53865632 GTCTGTATACATTTGTTCCTTGG - Intronic
907617570 1:55939976-55939998 TTTTATATACATAGTCTCCTTGG - Intergenic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
908186659 1:61658885-61658907 TTGTAGATGCAGATTTTCCTGGG - Intergenic
909372981 1:74908160-74908182 TTGTATATAAATATTTCTCTTGG + Intergenic
911393924 1:97281668-97281690 GTATATTTACTTATTTTTCTGGG - Intronic
911957087 1:104251031-104251053 GGGTATATATACATTTTCTTGGG + Intergenic
913323031 1:117603226-117603248 GTATATATATATTTTTTTCTTGG - Intergenic
914688312 1:150002487-150002509 GTGAATAGAGGTATTTTCCTAGG - Intronic
916003793 1:160641156-160641178 GAGCGTATACATATTTTTCTGGG + Intronic
918575423 1:186053152-186053174 GATTATAAACAAATTTTCCTGGG + Intronic
918865162 1:189887003-189887025 TTCTATATACCTATTTTCTTGGG - Intergenic
918890528 1:190260498-190260520 GTCCATATGCATATTTTCTTGGG + Intronic
918907660 1:190519099-190519121 GTGTATACACACATTATCCTAGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919341037 1:196306890-196306912 AAGTATATACGTATTTTTCTAGG + Intronic
919530564 1:198714018-198714040 TAGTATATATTTATTTTCCTTGG - Intronic
919553230 1:199018985-199019007 GTGTATATATATATTTATTTTGG + Intergenic
920071186 1:203304476-203304498 CTGTAAATTCCTATTTTCCTTGG - Intergenic
921380175 1:214516660-214516682 CTGTAAATATTTATTTTCCTTGG + Intronic
921865307 1:220082055-220082077 ATATATATATATATTGTCCTTGG - Intronic
922247371 1:223813610-223813632 GTGTCTAGACAAATTTTTCTAGG - Intronic
923495948 1:234524955-234524977 GGGTATGTACATATTTTTCTGGG + Intergenic
924393204 1:243586509-243586531 GTGTATATATATATATGCCATGG + Intronic
924488682 1:244513483-244513505 GTGTATATGCATGTTGTCCAGGG - Intronic
1064842499 10:19610584-19610606 GTGTATATGCATACTTATCTGGG + Intronic
1065083389 10:22149441-22149463 GCTTATATACATATGTTCTTTGG + Intergenic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065410003 10:25415376-25415398 TTATATATATATATTTTCTTTGG - Intronic
1065960303 10:30728485-30728507 GTGTATGTGTATATTTTCCCTGG - Intergenic
1066600409 10:37099844-37099866 GTATATATACATATACTCCATGG - Intergenic
1067225030 10:44370202-44370224 GTGCATATACATTTTTTCATTGG + Intronic
1067916538 10:50406008-50406030 GTGTATATATATATTTAGGTGGG - Intronic
1067991261 10:51215422-51215444 GGTCATATACATATTTTCTTAGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068459108 10:57303194-57303216 GTGCATAAAAATATTTTGCTAGG + Intergenic
1068671297 10:59726386-59726408 GTATACATACATATTTGCCATGG + Intronic
1071175204 10:82918038-82918060 ATGTATGTATATTTTTTCCTGGG + Intronic
1073203110 10:101752341-101752363 TGGTTTATACATATTTTCCCAGG - Intergenic
1074315601 10:112358995-112359017 CTATATATATATATATTCCTGGG + Intergenic
1074991778 10:118715197-118715219 GTGTATATATATATTTTTAGTGG - Intronic
1075793372 10:125101851-125101873 GTGTGTGTACATATATTCATGGG + Intronic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1078416111 11:11167145-11167167 GTGTATACAAATTTTTTTCTTGG - Intergenic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079682396 11:23314740-23314762 GTCTGAATATATATTTTCCTTGG + Intergenic
1079715577 11:23739454-23739476 TTGTACATATATATTTTTCTAGG + Intergenic
1079950028 11:26790549-26790571 ATGAACATTCATATTTTCCTGGG + Intergenic
1080789147 11:35505144-35505166 ATGTATTTGCATATTTTCCAAGG + Intronic
1081066996 11:38555262-38555284 ATGTATATATATATATTCTTGGG - Intergenic
1081097164 11:38951686-38951708 GAGTATATTAAGATTTTCCTAGG + Intergenic
1081139180 11:39476391-39476413 GTATATATATATATTTTTTTTGG + Intergenic
1081987773 11:47319106-47319128 ATATATATATATATTTTCCTTGG - Intronic
1082632063 11:55555221-55555243 GTGTATATACAAATATGCATGGG - Exonic
1084921419 11:72473562-72473584 GTGTCTATGCATATTTTCTCTGG + Intergenic
1085435531 11:76496778-76496800 GAGTATTTACATAGATTCCTTGG + Intronic
1085694908 11:78695867-78695889 GTGTATGTACTTATTCTGCTTGG + Intronic
1085889977 11:80567055-80567077 GTATATATACATATACTCCATGG + Intergenic
1086057334 11:82662318-82662340 GTGTATATATATATATTTTTTGG - Intergenic
1086119462 11:83290746-83290768 GTGTATTTTCAGATTCTCCTTGG + Intergenic
1086983504 11:93224320-93224342 ATGTATATACATATTTATATAGG - Intergenic
1087650840 11:100865559-100865581 CTGTATATACGTAGCTTCCTTGG + Intronic
1087742299 11:101901911-101901933 TATTATATATATATTTTCCTGGG - Intronic
1087978355 11:104578938-104578960 ATATATATACATATATTCCTGGG + Intergenic
1087981845 11:104623930-104623952 CTGAATTTAAATATTTTCCTGGG + Intergenic
1088572820 11:111240269-111240291 GTGTATATACATATGTGTATGGG - Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1088681243 11:112243763-112243785 ATGTGTATGCATATTTTCCAAGG - Intronic
1091084214 11:132705062-132705084 GTGTATTTATTTATTTTACTTGG + Intronic
1092382393 12:8007833-8007855 GTGTATATATATATTTAAATAGG - Intergenic
1092554793 12:9545867-9545889 GATTATATACTTATTTTTCTTGG + Intergenic
1092696105 12:11172968-11172990 GAGTATACACATGTTTTCTTCGG + Intergenic
1093034262 12:14318399-14318421 ATATATATATATAATTTCCTAGG - Intergenic
1093636468 12:21476446-21476468 GTATATATACATGGTTTTCTGGG - Intronic
1093668447 12:21842677-21842699 GTCTATCTACCTATTTACCTTGG + Intronic
1093946088 12:25111025-25111047 GTGTATGTACATATATGCATAGG - Intronic
1094517308 12:31144763-31144785 GATTATATACGTATTTTTCTTGG - Intergenic
1094653961 12:32403033-32403055 TCATATATAAATATTTTCCTAGG - Intronic
1095314047 12:40737303-40737325 GTGTATATACACATATACATGGG + Intronic
1095495082 12:42775740-42775762 GTCTATGTACAGTTTTTCCTTGG + Intergenic
1096181107 12:49550840-49550862 GTGTATATACTTCCCTTCCTGGG + Intronic
1097467571 12:59946942-59946964 CTGTATATAAATATTTTCAGAGG - Intergenic
1097497580 12:60360074-60360096 GTGCTTCTAGATATTTTCCTAGG - Intergenic
1098258096 12:68638171-68638193 TGGTATATAGATTTTTTCCTTGG + Intronic
1098677428 12:73307708-73307730 GTGTATGTATGTATTTTCCATGG - Intergenic
1099116591 12:78633574-78633596 TTCTATATACATATTTTCCAAGG - Intergenic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099796167 12:87402756-87402778 GTGTATATACAAATATTTGTAGG + Intergenic
1099900297 12:88699514-88699536 ATATATATATATATATTCCTAGG - Intergenic
1100061054 12:90575899-90575921 GTGTCTAGAAATATTTTCCAGGG + Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1102127966 12:110501343-110501365 GTGAATATACACATTTTTCTGGG - Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1103218328 12:119221372-119221394 GTGTATATATATATTTTTTATGG - Intergenic
1104359593 12:128120232-128120254 GTGTGTACACATATATTCATGGG + Intergenic
1105312618 13:19226395-19226417 GTGTATATATATATTTTTTGAGG - Intergenic
1108535857 13:51377165-51377187 TTGTATTTGCATATTTTCTTTGG + Intronic
1108811465 13:54229719-54229741 TTTTATATTCATATTTTCCAGGG + Intergenic
1108895331 13:55320043-55320065 GTGTAAATACATATATTTATAGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1110734527 13:78920425-78920447 GTTTATATACACATTTTGATAGG + Intergenic
1110951707 13:81501244-81501266 ATTTATTTACATATTTTTCTGGG + Intergenic
1111039305 13:82724214-82724236 GTGTATATACATGGTTTATTAGG - Intergenic
1111378950 13:87420393-87420415 GGGTATATACATATTTATATTGG + Intergenic
1111556309 13:89885233-89885255 GGTGATATATATATTTTCCTCGG + Intergenic
1111804019 13:93016160-93016182 ACATATATACATATTTTCCCTGG - Intergenic
1113285731 13:108846504-108846526 GTGTATATACATATATCCTTTGG + Intronic
1113976728 13:114233067-114233089 GTGTGTATACATATATGACTGGG - Intergenic
1115821138 14:37213161-37213183 GTGTACATGTATATTTTCTTTGG - Intronic
1116251877 14:42495833-42495855 ATACATATACCTATTTTCCTGGG - Intergenic
1116876318 14:50115672-50115694 GCGTATATACATATGGTCCCTGG + Intronic
1118036550 14:61874477-61874499 GTGTATGTACAGTTGTTCCTCGG - Intergenic
1118820976 14:69345746-69345768 GTGTATAAGCATATTTTCCTGGG + Intronic
1120045903 14:79805682-79805704 ATGTATATATATATTTTCCATGG + Intronic
1120466095 14:84859558-84859580 GTGTATATGCCTATGTTCCTAGG + Intergenic
1120589373 14:86357030-86357052 GTCTAGAAACATATTTTCCATGG - Intergenic
1120616731 14:86715480-86715502 CTGTTTATACTTTTTTTCCTGGG + Intergenic
1122009300 14:98732560-98732582 AAGCATATACTTATTTTCCTAGG - Intergenic
1122563544 14:102634694-102634716 GTGTATATATATATATTTTTTGG + Intronic
1123986336 15:25649621-25649643 GTGTATATGTACATTTTCCGAGG + Intergenic
1124025021 15:25958145-25958167 GTGGATAGAAATTTTTTCCTGGG - Intergenic
1124812188 15:32952166-32952188 TTGTATATACATATACTCTTGGG - Intronic
1125064321 15:35463781-35463803 GTGTATATATATATATCCATAGG - Intronic
1125260665 15:37821267-37821289 GTAAATATACATATTTTACAAGG + Intergenic
1125383273 15:39110335-39110357 CTTTATATACATCTTCTCCTGGG + Intergenic
1125864166 15:43028781-43028803 ATATATATATATATATTCCTTGG + Intronic
1126106665 15:45151297-45151319 GCTTATAAACATCTTTTCCTTGG + Intronic
1126135707 15:45388898-45388920 GTTTACATACATATATTGCTTGG + Intronic
1127004230 15:54547916-54547938 GTTTATATATAAATTTCCCTAGG + Intronic
1127854247 15:62941613-62941635 GTGGACATGCATATTTTTCTGGG + Intergenic
1128336552 15:66789794-66789816 GTTTATGTGCATGTTTTCCTAGG - Intergenic
1128773976 15:70304712-70304734 GTATATATACATATTTGTATAGG - Intergenic
1130783538 15:87070708-87070730 CGGAATATATATATTTTCCTAGG + Intergenic
1131451092 15:92540721-92540743 GTGTACATATATATGTTCTTTGG - Intergenic
1131782158 15:95871413-95871435 GTGTATTTCCATAGTTTCATTGG - Intergenic
1132426561 15:101723018-101723040 GTGTATATAGTTAATTACCTAGG - Intronic
1133913997 16:10092305-10092327 GTGTAGAGACTGATTTTCCTTGG - Intronic
1134241842 16:12512361-12512383 ATATATATATATATTTTCCCTGG - Intronic
1135288875 16:21217558-21217580 CTGTATATACAGTTTTTCATAGG - Intergenic
1135476467 16:22780479-22780501 ATGTAAATACATTTTTTTCTGGG + Intergenic
1135528329 16:23231041-23231063 ATATATATACATATTTACATGGG - Intergenic
1138322941 16:56133906-56133928 GTGTAAATAAATATTTTTCATGG + Intergenic
1138396117 16:56705947-56705969 GTGTATATACATGTAGTCTTGGG + Intronic
1139125722 16:64074083-64074105 CTGTATATACATTTTCTCATTGG - Intergenic
1140204107 16:72919751-72919773 GTGCATATACATGTTTTAGTTGG - Intronic
1140563944 16:76018765-76018787 ATGTATATATATATTTACATTGG - Intergenic
1140601895 16:76486372-76486394 GTGTAGATACATCTTTTCTTTGG - Intronic
1140612228 16:76614050-76614072 GTGTATATATATAATTTAATTGG - Intronic
1144143642 17:12375877-12375899 TTGTAAATACTCATTTTCCTTGG - Intergenic
1146556880 17:33832766-33832788 ATGTATATAAATATATTCCAAGG + Intronic
1147123128 17:38347847-38347869 ATATATATATATATTTACCTGGG - Intergenic
1147316996 17:39625778-39625800 GTGTACATGCATGTTTTCCTGGG - Intergenic
1147859146 17:43506850-43506872 GTGTATATTCCTCTTTTCTTTGG + Intronic
1149169056 17:53788188-53788210 GTTGATATAGATATTTACCTGGG + Intergenic
1149323722 17:55508425-55508447 ATATATATATATATATTCCTAGG - Intergenic
1149816785 17:59733400-59733422 GTGTATATGCATTTTGTGCTGGG + Intronic
1150100945 17:62423366-62423388 GTGTGTATATATATTTTGGTTGG - Intergenic
1150441531 17:65195483-65195505 ATGTATATATATATTTTTATTGG + Intronic
1150599469 17:66638025-66638047 CTTTATTTACATATTTTCTTTGG - Intronic
1150715038 17:67565227-67565249 GTGTGTATACTAATTTTCCATGG + Intronic
1150715041 17:67565256-67565278 GTGTGTATACTCATTTTCCATGG + Intronic
1150715051 17:67565435-67565457 GTGTGTATACTCATTTTCCATGG + Intronic
1150715072 17:67565786-67565808 GTGTGTATACTCATTTTCCATGG + Intronic
1153172665 18:2333833-2333855 ATATATATATATATTTGCCTGGG - Intergenic
1153484265 18:5580304-5580326 GTGTCTATACATATTTGTATGGG - Intronic
1155017083 18:21854355-21854377 ATTTATTTACATATTTTCCATGG - Intronic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156963062 18:43056467-43056489 CTGTAAATTCATATTTCCCTAGG - Intronic
1158031460 18:52970121-52970143 ATGTAAATATATATCTTCCTAGG - Intronic
1158244421 18:55414926-55414948 GTAAATATACTCATTTTCCTTGG + Intronic
1158286147 18:55885652-55885674 CTGAATATAAATATTGTCCTCGG + Intergenic
1158635939 18:59158054-59158076 GTGTATATATATATATTTTTTGG + Intronic
1160787819 19:909461-909483 GTGTATTTACATAGTTACATAGG + Intronic
1162638861 19:11991261-11991283 ATATATATACATATTTCCATAGG - Intergenic
1165406715 19:35635409-35635431 GTTTATATTCGTATTTCCCTAGG + Intronic
925105647 2:1288719-1288741 ATGTTTACACACATTTTCCTTGG - Intronic
927574958 2:24193265-24193287 GTGTATATACATATATTCAAAGG - Intronic
930431903 2:51288458-51288480 GTGTATCTACATTTTGTCGTAGG + Intergenic
931726754 2:65118835-65118857 TTGTATATACATATATACATAGG - Intronic
932524971 2:72455778-72455800 GTGTGTATACATATATACATGGG + Intronic
932978426 2:76632689-76632711 GTGTATATATGTATGTTCCCAGG - Intergenic
933020758 2:77187892-77187914 CTGTATTTATATATTTTCATAGG - Intronic
933325382 2:80829731-80829753 GTGTACATATAGACTTTCCTGGG + Intergenic
933418214 2:82014464-82014486 ATGTAGATACATATATACCTAGG + Intergenic
935895358 2:107731242-107731264 GTGTATTTTCATATTGTCCAAGG - Intergenic
936095983 2:109530523-109530545 GTGTCTATACATATCTATCTTGG + Intergenic
936680150 2:114760542-114760564 ATATATATATATATTTTCCTAGG + Intronic
936915432 2:117635037-117635059 ATGTATATCTATATTTTCTTAGG - Intergenic
937496345 2:122424190-122424212 GTGTATCTGCAAAGTTTCCTGGG - Intergenic
937859066 2:126694105-126694127 ATGTATATATATATTTACCCAGG - Intronic
938045607 2:128116971-128116993 TTTTAAATACATTTTTTCCTGGG - Intronic
939419265 2:141944624-141944646 TTGGATATATATATTTTCTTTGG - Intronic
939435486 2:142171622-142171644 GTGTATATATATATATTGCTTGG - Intergenic
939619178 2:144397595-144397617 ATGTATATACACATTTTAATAGG - Intronic
939693492 2:145294963-145294985 GTGTATATACATATTATATAAGG + Intergenic
939775065 2:146375416-146375438 ATAGATATACATATATTCCTGGG + Intergenic
939788284 2:146542857-146542879 GTGTGTATACATATATACATAGG - Intergenic
941522737 2:166568081-166568103 GTGAATATACAGATTTTCTATGG + Intergenic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
942500481 2:176584867-176584889 TTGTATCTAAATATTGTCCTTGG + Intergenic
942526117 2:176854715-176854737 GCACATATACATATTTTTCTGGG + Intergenic
942697900 2:178666552-178666574 ATGTGTATATATATTTTCTTTGG + Intronic
943135274 2:183902917-183902939 CTGTAAATAAATATTTTCCAGGG - Intergenic
943861788 2:192874598-192874620 GTGGATATAGATATGTTTCTAGG + Intergenic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
943992942 2:194720801-194720823 GTATATATATATATATACCTCGG + Intergenic
944185256 2:196940853-196940875 GTGTGTATGCATACTTCCCTTGG - Intergenic
944319773 2:198325890-198325912 ATGTATGTACACATTTTCTTTGG + Intronic
944355386 2:198781486-198781508 GTGTTTATCCATGTTTTCCTAGG + Intergenic
944552295 2:200855628-200855650 GTGTATATATATAATTTTTTGGG - Intronic
944802185 2:203247297-203247319 CTGTATATATATATTGTTCTTGG + Intronic
945449991 2:209982937-209982959 GTGTATATATATATATACATGGG - Intronic
945875701 2:215275894-215275916 GTGTGTATACATATTTTGACAGG - Intergenic
945875703 2:215275955-215275977 ATATATATACATATTTAACTGGG + Intergenic
946551813 2:220809816-220809838 TTGCATATACAGATTTTCCATGG + Intergenic
946790382 2:223295022-223295044 GAGTATAGGCATATATTCCTAGG + Intergenic
947397566 2:229701676-229701698 TTGTATGTAGATATTCTCCTGGG - Intronic
947515424 2:230800032-230800054 GTGTATATATGTATTTTCTTTGG - Intronic
948538116 2:238662962-238662984 GTATATATACATATATCCCCAGG - Intergenic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1170631007 20:18065190-18065212 TTATATATTCATGTTTTCCTGGG - Intergenic
1173871560 20:46345243-46345265 GTGCATTTACATGTTTTTCTGGG - Intergenic
1174715197 20:52750314-52750336 GTGGATATTCATAATGTCCTCGG + Intergenic
1175670987 20:60902723-60902745 GGGTATATTCATATTCACCTGGG + Intergenic
1175671003 20:60902812-60902834 GGGTATATTCATATTCACCTGGG + Intergenic
1177300248 21:19234824-19234846 ATGTTTATACATATATTCCTTGG + Intergenic
1177439038 21:21095285-21095307 ATGTGTATAAATTTTTTCCTTGG - Intronic
1177554332 21:22670502-22670524 GTTTATATACCCATTTTCATAGG + Intergenic
1177717808 21:24862761-24862783 GTTGATGTAAATATTTTCCTGGG + Intergenic
1178744988 21:35240378-35240400 GTGGTTATAAATATTTTCCCAGG + Intronic
1179644049 21:42764833-42764855 GTATATATATATATTTTTTTGGG - Intronic
1182175525 22:28282905-28282927 ATATATATACATATATTCCCTGG + Intronic
1183028324 22:35083113-35083135 GTGTGTTTACATATTTTCTGAGG - Intronic
1183566037 22:38616052-38616074 CTGTATCTACATATTCTCCCTGG - Intronic
1184932194 22:47689723-47689745 GTTTAAATACATATTTGCATAGG - Intergenic
949690688 3:6634293-6634315 GTGTGTATAAATACTTTCATAGG - Intergenic
950571770 3:13804729-13804751 GTGCATATATATATATGCCTAGG - Intergenic
950996915 3:17510283-17510305 ATGTATATGAATATTTTACTAGG - Intronic
951144792 3:19214221-19214243 GTGTAACTATATATTATCCTAGG - Intronic
952203697 3:31157782-31157804 GTATGTATATATATTTTGCTAGG + Intergenic
953022723 3:39125957-39125979 GTGTATAAAAATATGATCCTTGG - Intronic
953100046 3:39815681-39815703 CTGTTTATATATTTTTTCCTTGG + Intronic
953210979 3:40875123-40875145 CTGTATAGGCATATTTACCTAGG + Intergenic
953475072 3:43198640-43198662 GTGTATAAATATATTTTGGTTGG - Intergenic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
957003897 3:74920967-74920989 GTGCATATGCATATATTCTTGGG - Intergenic
957164741 3:76657752-76657774 ATGTATATATATATGTTCATAGG + Intronic
957386897 3:79507632-79507654 GTGTATATCCACATTTTACTTGG + Intronic
957458368 3:80483494-80483516 GTGTATATATATATGTACATAGG - Intergenic
957828892 3:85489001-85489023 ATTTATTTATATATTTTCCTGGG + Intronic
958981003 3:100719434-100719456 GAATATATAAATATTTTTCTGGG + Intronic
959048510 3:101501331-101501353 ATATATATAAATATTTTACTGGG - Intronic
960306144 3:116063113-116063135 GTGTCTATACATAAATACCTTGG + Intronic
960350753 3:116589688-116589710 CTGTATGTACATATTATCTTAGG - Intronic
960406964 3:117273179-117273201 TCTTATATACATACTTTCCTAGG + Intergenic
960451606 3:117816234-117816256 GTGTATATATATATAATACTAGG + Intergenic
960627162 3:119692344-119692366 GAGTCTATACAGATTTTCCTTGG - Intergenic
961111504 3:124287762-124287784 ATATATATATATATCTTCCTAGG - Intronic
961227548 3:125266086-125266108 GGCTGTATACATCTTTTCCTAGG - Intronic
961879928 3:130054411-130054433 GTGTACATTCATATATTCCCAGG - Intergenic
962747813 3:138410515-138410537 GTGTATACATATATTCTTCTGGG + Intergenic
963471296 3:145745428-145745450 GTGTATATACACGTCTTGCTGGG - Intergenic
964542560 3:157795874-157795896 GTGCATATACACATGTGCCTGGG + Intergenic
965245413 3:166260693-166260715 GTGTATATATATATTTATCCAGG + Intergenic
965660133 3:171032439-171032461 GTGAATATAAATCTTTTCTTTGG + Intergenic
966049572 3:175597979-175598001 GTGTATAGACATACATTTCTGGG + Intronic
966091937 3:176148993-176149015 GTATATATTCTTATTTCCCTTGG - Intergenic
966260255 3:177969136-177969158 GTGTATATGAATATTTGCCAAGG + Intergenic
967349666 3:188498937-188498959 TTGTATATATATATCTTCTTTGG + Intronic
967688612 3:192446752-192446774 GTGTATGTCCATGTTTGCCTTGG - Intronic
967819070 3:193824600-193824622 CTGTATAAACATAGTTTTCTTGG + Intergenic
968973368 4:3808408-3808430 ATTTATATAAATGTTTTCCTGGG + Intergenic
969096843 4:4739453-4739475 TTTAATACACATATTTTCCTTGG - Intergenic
969223298 4:5775754-5775776 CTGTGTGTACATATTTTTCTTGG + Intronic
969381820 4:6805154-6805176 GTTTATTTAAATATCTTCCTAGG + Intronic
970180981 4:13393462-13393484 GCTTATATATATATTTTTCTTGG - Intronic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
971192643 4:24442010-24442032 GTTTATATTCATTTTCTCCTTGG + Intergenic
971547054 4:27899262-27899284 GTGTATATATATATTTATTTGGG - Intergenic
971571417 4:28216060-28216082 CTGTATATTCACATTTGCCTTGG - Intergenic
971759858 4:30751617-30751639 GTATATATATATATTTTGCATGG + Intronic
972180576 4:36459762-36459784 GTTTATATATATATTTTTGTTGG + Intergenic
972475000 4:39441858-39441880 GTGTCTATACATATATTTATTGG - Intronic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
973065120 4:45780545-45780567 ATGTATATATATATTTCACTGGG - Intergenic
973304172 4:48625276-48625298 ATGTGTATACATTTTTTCCCTGG - Intronic
974776963 4:66496745-66496767 ATGTAAAGACATCTTTTCCTCGG - Intergenic
975939864 4:79629717-79629739 ATTTATCTACATATTTTCTTTGG - Intergenic
976783015 4:88783008-88783030 GTGTATATACATAAATTACAGGG + Intronic
976819126 4:89185154-89185176 GTATATATATTTATTTTGCTAGG - Intergenic
976979561 4:91209824-91209846 ATCTATATAAATATTTTGCTTGG - Intronic
977785088 4:101023610-101023632 TTGCATCTAAATATTTTCCTTGG + Exonic
978235975 4:106461007-106461029 CTGTATATATATATCTTCATTGG - Intergenic
978564027 4:110063228-110063250 ATTTATATAGATATTTTTCTTGG + Intronic
978701229 4:111648774-111648796 ATGTATTTGGATATTTTCCTTGG - Intergenic
978717433 4:111862910-111862932 ATGAAGTTACATATTTTCCTGGG + Intergenic
979298402 4:119058421-119058443 CTTTATAAAAATATTTTCCTTGG + Exonic
979359256 4:119742452-119742474 GAGTATTCACATAGTTTCCTAGG - Intergenic
979613583 4:122716743-122716765 GTGTATATATATAATTTCCCTGG + Intergenic
980106034 4:128589244-128589266 GTGTATATACACATACTCTTGGG + Intergenic
980679922 4:136147095-136147117 GTGCAGAAACATATTTTCCTTGG - Intergenic
980836112 4:138194606-138194628 GTATATATAGACATTTTTCTTGG - Intronic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981227293 4:142312372-142312394 GAGGATAAAGATATTTTCCTGGG - Intronic
981304054 4:143226943-143226965 ATGTTTATACTTCTTTTCCTGGG - Intergenic
981681208 4:147400709-147400731 GTATATATACATATTTTAAAGGG + Intergenic
981951418 4:150413067-150413089 ATATATATATATATTTTCTTTGG - Intronic
982085308 4:151829645-151829667 GAGTATATATAAATTTTACTTGG - Intergenic
982643688 4:157995348-157995370 GTATATATACATACCTTGCTTGG + Intergenic
983162078 4:164428667-164428689 GTGTGTAAACATTTTTGCCTTGG - Intergenic
983450505 4:167905369-167905391 GTGTATATACATATATGTATAGG - Intergenic
984037096 4:174683202-174683224 ATGCATATACATTCTTTCCTTGG + Intronic
987996106 5:25281794-25281816 GTGTCTTTAGATATTTTCCCAGG - Intergenic
988206897 5:28149075-28149097 GTCTATATAAATATTGTCATGGG + Intergenic
988296661 5:29372132-29372154 GTCAATATAAATAGTTTCCTGGG + Intergenic
989207079 5:38820731-38820753 GTGTATATTCATATATGCATAGG - Intergenic
989207080 5:38820765-38820787 GTGTATATTCATATATACATAGG - Intergenic
989230740 5:39083937-39083959 GTTTATATGCTTATTTTCCATGG - Intergenic
989466604 5:41763673-41763695 GTTTCTATACATAGTGTCCTTGG + Intronic
989698860 5:44237459-44237481 GTGTATTTACATATATGCCCTGG + Intergenic
991573924 5:68083157-68083179 GTCTATGGACATATTCTCCTGGG - Intergenic
991800471 5:70357367-70357389 GTATATATACATTTTTTTTTCGG + Intergenic
991828129 5:70652674-70652696 GTATATATACATTTTTTTTTCGG - Intergenic
991892829 5:71356807-71356829 GTATATATACATTTTTTTTTCGG + Intergenic
993021289 5:82594751-82594773 GTAAATATATATACTTTCCTTGG - Intergenic
993186415 5:84627383-84627405 AAGTATATACATATTTGCTTTGG + Intergenic
993220048 5:85082893-85082915 ATGTACATCCATATTTTCATGGG + Intergenic
993599117 5:89898576-89898598 GTGTATAATCATATTATTCTTGG - Intergenic
994001345 5:94783917-94783939 GTGTGTTTACTTCTTTTCCTTGG + Intronic
994123102 5:96139485-96139507 GTGTATATATATATGTTACAAGG - Intergenic
994238253 5:97390983-97391005 ATTTATATGCATATTTTCTTGGG + Intergenic
994467825 5:100161436-100161458 GTGAATGTAAATATTTGCCTTGG - Intergenic
994580074 5:101630230-101630252 GTGTATGTACAAAATTTACTGGG - Intergenic
995085121 5:108099593-108099615 ATGTTTGTACAGATTTTCCTTGG + Intronic
995103243 5:108342382-108342404 GTGTATTTAAAAATTTTTCTAGG - Intronic
995419360 5:111945941-111945963 CTGTATATACAACTTGTCCTTGG - Intronic
995608494 5:113884236-113884258 TTGTTTATACATAATTTTCTTGG + Intergenic
995716831 5:115088604-115088626 TTCTATGTACATATTTTCATTGG - Intergenic
996591761 5:125155774-125155796 GTGTATATATTCATTTGCCTAGG + Intergenic
997175633 5:131773605-131773627 GTGCATAAACACATTTTTCTAGG - Intronic
997207457 5:132058195-132058217 GTGTATATATATAATTTTTTTGG + Intergenic
998662714 5:144257961-144257983 ATGGATATACATATTGTCCAGGG - Intronic
998945187 5:147331533-147331555 GTTTAGATACATATTTTAGTGGG + Intronic
999814768 5:155164815-155164837 GTGTTTAAAAATATGTTCCTTGG + Intergenic
1000894500 5:166839176-166839198 ATGTATATACATATTGTCTGTGG - Intergenic
1000925677 5:167191165-167191187 GGGTGTATATATATATTCCTAGG - Intergenic
1002375536 5:178786451-178786473 GTGTATAAATATATTTCCCCCGG + Intergenic
1002388138 5:178886413-178886435 TTGTATATTGATGTTTTCCTGGG - Intronic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1003103020 6:3191929-3191951 GTATATATATATATTTTTTTTGG + Intergenic
1003210564 6:4060993-4061015 GTTTATATTCACGTTTTCCTAGG + Exonic
1003750069 6:9045345-9045367 GTGTATTTACTTATTTTTCAAGG - Intergenic
1003754968 6:9107531-9107553 TTGAATAAATATATTTTCCTGGG - Intergenic
1004262409 6:14119432-14119454 ATGTATGTAAATATTTACCTTGG - Intronic
1004450124 6:15737429-15737451 GCTTATATAGATACTTTCCTAGG - Intergenic
1004946659 6:20621528-20621550 GTGTATCTACATAATTTATTTGG + Intronic
1005087244 6:22019774-22019796 GTTTATTTACATATTTTCCTAGG + Intergenic
1005662217 6:28010200-28010222 AAGTATATACATATGATCCTGGG - Intergenic
1007770809 6:44190738-44190760 TTGTATAAAAATATTTTACTGGG - Intergenic
1007984480 6:46194023-46194045 GGTTATAGACTTATTTTCCTAGG + Intergenic
1008880956 6:56379598-56379620 GTTTATGTACATATGTTTCTAGG - Intronic
1009688589 6:66996218-66996240 GTGTATATGCAATTTTTCATAGG - Intergenic
1009734056 6:67652289-67652311 GTATATAAACATATCTTCTTAGG - Intergenic
1009988414 6:70810476-70810498 GTGGATATATATATTTCCATGGG - Intronic
1010398350 6:75418723-75418745 GTTTATTTATATATTTTTCTTGG - Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1010548738 6:77192565-77192587 GTGTATATTCCTAGTTTACTTGG - Intergenic
1010568681 6:77451019-77451041 GTGCATTTACATATTTTTCTTGG - Intergenic
1011909565 6:92419751-92419773 GTGTATATATATATCTTGATTGG - Intergenic
1012110094 6:95219314-95219336 ATGTATATATATATTTTTGTTGG - Intergenic
1012124051 6:95404707-95404729 GGGTATATTCATATTTCTCTAGG + Intergenic
1012347918 6:98214293-98214315 GTGTATCTCCTTATTTTCCTAGG - Intergenic
1013199293 6:107877117-107877139 GTGTATATATATATTTTAGAAGG + Intronic
1013210735 6:107984450-107984472 GTGTATATATATATTAGGCTAGG + Intergenic
1014077675 6:117255027-117255049 GTTTATATACATCTGTTTCTAGG + Intergenic
1014462580 6:121714940-121714962 ATGTATATACATATATTCTAGGG + Intergenic
1014602137 6:123426493-123426515 GTGTCTATACATATTTTTAGAGG + Intronic
1014867899 6:126554544-126554566 GTGTATATATATATATTCACTGG - Intergenic
1015793934 6:136991907-136991929 GTGTATTCCCATATATTCCTTGG + Intergenic
1015956474 6:138603758-138603780 GCAACTATACATATTTTCCTTGG - Intronic
1017020902 6:150139702-150139724 GTGTATTTAATTATTTTCCTGGG + Intergenic
1017505676 6:155066673-155066695 GTGTATATATATAATTTTTTTGG + Intronic
1017553942 6:155542801-155542823 TTGCATATTCAGATTTTCCTTGG - Intergenic
1018984654 6:168627088-168627110 TTTTCTATACATATTTTTCTTGG - Intronic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1020713515 7:11638847-11638869 GTGAATATATATTTTTTCTTTGG - Intronic
1021027830 7:15689974-15689996 GTGTATATCTATTGTTTCCTCGG + Intergenic
1022564762 7:31386879-31386901 GTGTATATACATATACACGTGGG + Intergenic
1023230882 7:38027769-38027791 GTGTATTAACATTATTTCCTGGG - Intergenic
1024206957 7:47171626-47171648 TTTTATATGCATATTTTCTTTGG - Intergenic
1025281735 7:57630659-57630681 TTTTATAAACATAATTTCCTGGG + Intergenic
1025302994 7:57834858-57834880 TTTTATAAACATAATTTCCTGGG - Intergenic
1025556551 7:62316646-62316668 GAATATATACACATTTTCTTGGG + Intergenic
1026041420 7:66871319-66871341 GTGGATGTACATATTGTCCATGG + Intergenic
1026294968 7:69043399-69043421 GTGTATATATATATATTTATAGG - Intergenic
1027331765 7:77103738-77103760 CTTTCTCTACATATTTTCCTAGG - Intergenic
1027399462 7:77792710-77792732 GTTTATATACCTATTGTCCTGGG - Intergenic
1027454287 7:78368557-78368579 TTATATACACATATTTTTCTTGG - Intronic
1027519446 7:79186183-79186205 ATATATATATATATTTTCCCAGG - Intronic
1027768727 7:82379567-82379589 GTGTCTATACTTGTTGTCCTGGG + Intronic
1028302631 7:89220177-89220199 GTGTATATATATATATCCTTGGG + Intronic
1028400036 7:90415633-90415655 CTGTAAATAATTATTTTCCTTGG - Exonic
1029784008 7:102767598-102767620 CTTTCTCTACATATTTTCCTAGG + Intronic
1030415104 7:109233219-109233241 GTTTATATTCAGATTTTCCCAGG - Intergenic
1032030094 7:128476229-128476251 GTGTGTATATATATTTTGGTTGG - Intergenic
1032175008 7:129616034-129616056 GTGTATATATATATATTCTAAGG - Intronic
1035910752 8:3563500-3563522 GTGTAAATACCTATTTTCTTTGG - Intronic
1037193455 8:16156252-16156274 CTGTATATATTTGTTTTCCTTGG - Intronic
1037265803 8:17058340-17058362 GTGTATATCCTTATATTACTAGG - Intronic
1037357491 8:18037547-18037569 GTGTATATATATATTTTGGCTGG + Intergenic
1037575052 8:20194637-20194659 GTGCATATGGATATTTTCCGTGG - Intergenic
1038460607 8:27713502-27713524 GTTCATTTACATATTTTCATCGG + Intergenic
1038510889 8:28134288-28134310 GTCTCAGTACATATTTTCCTTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1039642171 8:39235622-39235644 GTGTAAAAACAAATTTTACTGGG + Intronic
1041343673 8:56872572-56872594 TTATATATATATATTCTCCTAGG - Intergenic
1042220141 8:66465503-66465525 ATGTATATATATATATTCTTTGG + Intronic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1043199257 8:77342734-77342756 GTGTATGTACATATTTTCCATGG + Intergenic
1043228190 8:77761589-77761611 TTATATATATATATTTACCTTGG - Intergenic
1043251073 8:78073934-78073956 GTGTTTGCATATATTTTCCTGGG + Intergenic
1044105402 8:88198870-88198892 CTGAATATTCATATTTTCCCTGG - Intronic
1044333488 8:90948175-90948197 GTGCATATATATGTTTTCCTAGG - Intronic
1044437538 8:92182807-92182829 GTGTATTTACACTATTTCCTGGG - Intergenic
1044492701 8:92838660-92838682 GTGTAGATTCTTATTTTCTTTGG + Intergenic
1045068608 8:98477071-98477093 TTGTTTGTACAGATTTTCCTCGG - Intronic
1045541428 8:103089937-103089959 GTGTATATTCTTATCTTCCCTGG + Intergenic
1045558704 8:103239946-103239968 TTGAATATACATATTTACTTGGG - Intergenic
1046091485 8:109508075-109508097 ATATATATACATATGTTTCTAGG + Exonic
1046724745 8:117662282-117662304 GTGTTTAAAAATATTTTCCCTGG - Intergenic
1047166743 8:122447721-122447743 TTGTATTTACATGGTTTCCTGGG - Intergenic
1048160066 8:132010560-132010582 TTGTATATACATATTTTCCAAGG + Intronic
1050705932 9:8397437-8397459 CTGTATTAACATATTTTCCTAGG + Intronic
1050788421 9:9434700-9434722 TTGTATATACATATATTTCTGGG - Intronic
1051019901 9:12531206-12531228 TGGTATATATATATTTCCCTTGG - Intergenic
1051627863 9:19115206-19115228 GTGCATATTCAAATTTTACTAGG - Intronic
1051676374 9:19562619-19562641 CTGTACATACATATTTTTTTAGG - Intronic
1052108914 9:24555067-24555089 GTGGATTTACAAATTTTACTGGG - Intergenic
1052723675 9:32203300-32203322 CTGGATATACATAGCTTCCTGGG + Intergenic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1055540795 9:77303148-77303170 TTGTATATACATAATCACCTTGG + Intronic
1057115800 9:92520328-92520350 GTCTATCTGCATATCTTCCTTGG - Intronic
1057644699 9:96862035-96862057 GTGTATATGTACATTTTCTTTGG - Intronic
1058008496 9:99946350-99946372 AAGTATATACATTTATTCCTTGG - Intronic
1058253471 9:102731041-102731063 GTCTATATAGACATTTTCCATGG - Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058611841 9:106786131-106786153 ATTTATATAAATATTTTCCGAGG + Intergenic
1060805557 9:126573794-126573816 GTATATATATATATTTGGCTGGG - Intergenic
1060907828 9:127323756-127323778 GTGTATATATATATATTTATGGG - Intronic
1061102702 9:128504384-128504406 ATATATATATATATTTACCTAGG + Intergenic
1185454303 X:300706-300728 GTGTATATATATATTTTTTGAGG + Exonic
1185962414 X:4559403-4559425 ATGTCTAAACATATTTTCTTGGG + Intergenic
1186328275 X:8504033-8504055 GTGTATAAACATATATTTCCAGG + Intergenic
1187340574 X:18417582-18417604 ATATATATACATATATTCCCTGG + Intergenic
1187410686 X:19048252-19048274 GTTCATATGCATTTTTTCCTGGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189237604 X:39499767-39499789 GTGTATATGTACATTTTCTTTGG + Intergenic
1189485998 X:41432532-41432554 GTGTATATATATATTTTTTGAGG - Intergenic
1189993761 X:46619409-46619431 GTACATATACATATTTTTTTTGG - Intronic
1190008936 X:46766495-46766517 GGATATATACATATATACCTAGG - Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1192094643 X:68197852-68197874 GTTAATATACATAGTTTACTTGG - Intronic
1192534902 X:71918842-71918864 GTGGTTATATAAATTTTCCTAGG + Intergenic
1192619183 X:72659874-72659896 GTGTATTTACATATTGTCCATGG - Intronic
1192869847 X:75174820-75174842 GTGTAGATAGAAATTTACCTTGG + Intergenic
1193784985 X:85749974-85749996 GTCTATATGCCTATTTTCATAGG + Intergenic
1194000517 X:88422915-88422937 ATGTATATAAATATTTTCCATGG - Intergenic
1194303187 X:92211870-92211892 GTGTCTTTACTTATTTTCCAAGG + Intronic
1194456585 X:94111327-94111349 GTGTATATCCATACTTTCATAGG + Intergenic
1194759675 X:97780660-97780682 GTATAAATATATATTTTGCTTGG + Intergenic
1194902024 X:99523756-99523778 ATGTATATACATAGTTTTCATGG - Intergenic
1194907945 X:99602192-99602214 GTATATGTACATTTTTTTCTTGG - Intergenic
1195611534 X:106872442-106872464 ATATATATAAATATTTTTCTGGG - Intronic
1196347449 X:114680585-114680607 GTGTTTGTACAGATTTTTCTTGG + Intronic
1196696988 X:118623862-118623884 GTGTATATACATATCTGGCGAGG + Intronic
1196744574 X:119058533-119058555 GTATATATACATATTTGGTTTGG + Intergenic
1196979525 X:121196127-121196149 TTGTGTATACATATATACCTAGG + Intergenic
1197884064 X:131199827-131199849 TTTTATATACATATTTTTATTGG - Intergenic
1198012952 X:132577955-132577977 GTGTGTATACATATTTATGTAGG + Intergenic
1198122700 X:133609872-133609894 GTGTATCTATATACTTGCCTTGG + Intronic
1198778887 X:140212963-140212985 GTGTATATACATATATGTATGGG - Intergenic
1200337950 X:155369877-155369899 ATATATATATATATATTCCTGGG - Intergenic
1200348520 X:155471349-155471371 ATATATATATATATATTCCTGGG + Intergenic
1201433864 Y:13934733-13934755 GTGTATAAACATATATTTCCAGG - Intergenic
1201518846 Y:14849906-14849928 TTGTAAATTCTTATTTTCCTAGG - Intergenic
1201752900 Y:17453274-17453296 GTGTCTAAAAATATTTTCTTGGG + Intergenic