ID: 1088593028

View in Genome Browser
Species Human (GRCh38)
Location 11:111419532-111419554
Sequence GTCTCCCTTGGGACTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088593021_1088593028 22 Left 1088593021 11:111419487-111419509 CCAAAGGCAAGAGAAGGTGTCAA 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1088593028 11:111419532-111419554 GTCTCCCTTGGGACTAGGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088593028 Original CRISPR GTCTCCCTTGGGACTAGGGT GGG Intronic
900588018 1:3442759-3442781 GTGTCCTTTGGGATTAGGGAGGG + Intergenic
904455507 1:30645649-30645671 GTCCACCTGGGGACTGGGGTGGG + Intergenic
905043474 1:34978438-34978460 TACTCCCTTGGGAAGAGGGTAGG - Intergenic
905865883 1:41376432-41376454 GTCTCTCTGGGGAGCAGGGTGGG + Intronic
905920490 1:41715742-41715764 GTGACCCTTAGGACTATGGTTGG + Intronic
906040801 1:42786449-42786471 ACCTCCCTTTGGACTTGGGTTGG - Intronic
907694324 1:56706632-56706654 GTCTCCATTGGGATTTGGGTTGG + Intronic
908025983 1:59952077-59952099 GTCTCATTTGGGACCAGGGTGGG - Intergenic
908955091 1:69615279-69615301 GCTTCCCTTGGAGCTAGGGTCGG + Intronic
910867755 1:91803673-91803695 GGCTCCTTTGGGACAAAGGTTGG - Intronic
911887916 1:103327116-103327138 GTCTAGTTTGGGACTAGGGGAGG + Intergenic
915278097 1:154803554-154803576 GTCTGCCTGGGGACTACAGTGGG - Intronic
917265761 1:173218954-173218976 ATTTCCCTTGGGAATAGGGTTGG + Intergenic
918150926 1:181797724-181797746 GTTTCCCTTGGGAATAGGTGAGG + Intronic
1068061900 10:52078946-52078968 GTCTCCCATGAGAATAGAGTTGG + Intronic
1071479768 10:86056453-86056475 GGCACCCTTGGGACACGGGTTGG - Intronic
1072661122 10:97364093-97364115 TTATCCCTAGGGCCTAGGGTGGG - Intronic
1072752658 10:97994318-97994340 CTCTCCTTTGGGGCTAGGGATGG + Intronic
1072879231 10:99207809-99207831 GTATCCCTTGTGAATAAGGTGGG - Intronic
1076772075 10:132671247-132671269 GCCTCCCTTGGGCCCAGGGGAGG - Intronic
1077246578 11:1542200-1542222 GTCACCCTTGGGAGCAGGCTGGG + Intergenic
1083550959 11:63589950-63589972 GTCACAGTTGGGACAAGGGTGGG - Intronic
1084502650 11:69544082-69544104 TTCTCCCATGGAAATAGGGTGGG - Intergenic
1084608639 11:70186948-70186970 GGCTCCCTTGGGATAAGGCTGGG - Intronic
1085269324 11:75260959-75260981 GTGTCCCTTGGGCCTAGGCCAGG + Intergenic
1088593028 11:111419532-111419554 GTCTCCCTTGGGACTAGGGTGGG + Intronic
1089403858 11:118181377-118181399 GGATTCCTTGGGACTGGGGTGGG - Intergenic
1090261483 11:125324032-125324054 GCCTCTCTTGGGACTAGTTTTGG - Intronic
1090973170 11:131660172-131660194 GTGTCCCGTAGGACTCGGGTGGG + Intronic
1092113881 12:5984989-5985011 GTGCCCCCTGGGGCTAGGGTTGG + Intronic
1094272275 12:28630045-28630067 TTTTCTCTTGGGACTAGAGTAGG - Intergenic
1101823613 12:108203157-108203179 TTGTCCCTTGGCACCAGGGTAGG - Intronic
1102070180 12:110012455-110012477 TTCTCTCTTGGGACAAGGGATGG + Intronic
1103209505 12:119156411-119156433 GTTTCCCTTGGGACAAGACTGGG + Intronic
1103855965 12:123972128-123972150 CTCCCCCTTGGCACTGGGGTGGG + Intronic
1110063606 13:71071931-71071953 GTCTGCTATGGGACTAGGGGTGG + Intergenic
1111695274 13:91615440-91615462 GTCTCCCTTGAAACTAGGTGTGG - Intronic
1119485657 14:74984961-74984983 GTCTCCCTGGGGACTGTGGGAGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121509476 14:94501671-94501693 GTGTCCCTTGGGGCGGGGGTGGG - Intronic
1122633448 14:103118721-103118743 GTGTCCCGTGGGGCTGGGGTGGG + Intergenic
1124406665 15:29398835-29398857 CTCTCCCTTGGGCCGTGGGTGGG + Intronic
1127275084 15:57436243-57436265 GTCTCCCTTGCGGCTGGGGGTGG + Intronic
1128632005 15:69277625-69277647 GTCTCCTTTGGCCCTAGGCTTGG + Intergenic
1129962383 15:79699103-79699125 GACTCCCTTGGGACTCGGACTGG - Intergenic
1131466609 15:92660603-92660625 ACCTGCCTTGGAACTAGGGTTGG + Intronic
1132897113 16:2234348-2234370 GCCACACTTGGGACAAGGGTAGG - Exonic
1132986222 16:2769007-2769029 GCCTCCTTTGGGGCTGGGGTGGG - Exonic
1133415736 16:5605605-5605627 GTCTGCCTTGGGTCTAGGAGGGG + Intergenic
1134022457 16:10930450-10930472 GTCGACCTTGGAAATAGGGTAGG - Exonic
1138196843 16:55058307-55058329 GTCTCCCTTGAAACTGGGGTTGG + Intergenic
1138431633 16:56972691-56972713 GTTTCCCTTGCAGCTAGGGTGGG - Intronic
1139464169 16:67145272-67145294 GTGTCCCTTTGCACTGGGGTTGG - Intronic
1139849577 16:69942485-69942507 GTCCCTCTGGGGACAAGGGTTGG - Intergenic
1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG + Intergenic
1141803370 16:86325522-86325544 GCCTCCCTTGCAGCTAGGGTTGG + Intergenic
1143892855 17:10115745-10115767 TTCTCCCCAGGGACTAGGGGCGG - Intronic
1144658030 17:17050556-17050578 CCCTCCCTTGGGCCTTGGGTTGG + Intronic
1144671451 17:17134805-17134827 GCCTCCCTTGGGAGGTGGGTGGG + Intronic
1145975481 17:28981583-28981605 ATCTCCCCTGGGCCTAGGGTGGG + Exonic
1146401932 17:32506375-32506397 GTCTCATTTGGGAGGAGGGTAGG + Intronic
1148853021 17:50563852-50563874 GTGTCTCTTGGTACTTGGGTAGG - Intronic
1150213465 17:63454157-63454179 GTCCCCCTTGGGAGCAGGGCAGG - Intergenic
1150835108 17:68556859-68556881 GTATACCTTGGGTCTGGGGTGGG + Intronic
1151408096 17:73902459-73902481 GTCTCCGTTGGAACTCGGGTAGG - Intergenic
1152937023 17:83145109-83145131 GCATCCCTGGGGACTAGGCTTGG - Intergenic
1154168930 18:12036790-12036812 GGCTCACTTGGGACTAGGCAAGG + Intergenic
1155322432 18:24632326-24632348 GTCTCCCTTGGGATCAGAGCAGG + Intergenic
1157762924 18:50277192-50277214 GTCTCCTGTGGGGCTAGGGATGG + Exonic
1159411147 18:68076182-68076204 GTCTCCCTTTTGATGAGGGTCGG - Intergenic
1161532342 19:4797541-4797563 AGCTCCCTTGAGACTGGGGTGGG + Exonic
1162034918 19:7933565-7933587 GCCTCCCTGGGGAAGAGGGTGGG + Exonic
1162481036 19:10927361-10927383 GCTTCCCTGGGGAATAGGGTAGG - Intronic
1163238284 19:16042655-16042677 TTGTCCCTTGGGACCAGGGAAGG - Intergenic
1164868265 19:31623063-31623085 GACTTCCTGGGGACTGGGGTTGG + Intergenic
1165834709 19:38747149-38747171 GACTCCCGTGGGGCTGGGGTGGG - Intronic
1166050753 19:40257360-40257382 GCCTCCCCTGGGACTAGGCCAGG - Intronic
1168109722 19:54185400-54185422 ATTTCCCCTGGGCCTAGGGTTGG + Intronic
925288456 2:2730808-2730830 GCCTCCCTAGGGAAGAGGGTCGG - Intergenic
925401393 2:3575693-3575715 GTTTCCCTGGGGTCTGGGGTGGG + Intronic
925623417 2:5817365-5817387 TTCTCCCTGGGGCCTAGGATGGG + Intergenic
929195952 2:39184322-39184344 GTCTCTCTTGGGCCTAGTGCAGG + Intronic
930584505 2:53253470-53253492 CCCTCCCTTGAGACTAGGTTGGG + Intergenic
930800176 2:55435651-55435673 GCCACCCGGGGGACTAGGGTTGG + Intergenic
935834164 2:107031950-107031972 GACTCTGTTGGGATTAGGGTTGG - Intergenic
937041973 2:118829539-118829561 GTCTCCCTTTGTCCTAGGTTTGG - Intergenic
937483966 2:122294328-122294350 GACTCCATTTGGGCTAGGGTGGG + Intergenic
941323521 2:164084909-164084931 GTCTACCTTGGGTTTAAGGTAGG + Intergenic
944583387 2:201152623-201152645 CTCACCCTTGGGCCTAGGGCAGG - Intronic
946309623 2:218876163-218876185 GTCTTCCTTGGGACTTCTGTTGG - Intergenic
947824532 2:233095837-233095859 GTCAACAGTGGGACTAGGGTGGG - Intronic
948173249 2:235923522-235923544 GTCACCCTTGTGAGTGGGGTGGG - Intronic
948272960 2:236688008-236688030 GCCTCCCTGGGGACGGGGGTGGG + Intergenic
948851810 2:240711913-240711935 CTCTCCCTGGGGACTGGGTTGGG + Intergenic
948971381 2:241430173-241430195 GTCTCCCTTGGGCCAAATGTGGG - Intronic
1169703274 20:8473116-8473138 GTGTCCCTTGGGATGAGGTTTGG - Intronic
1171371235 20:24663547-24663569 GTCTCCCTGGGGCCTGGGCTGGG - Intronic
1171451043 20:25236633-25236655 GTTTCCCTTGGGAGTGGTGTGGG - Intergenic
1172092544 20:32444445-32444467 GTGGCCCTTGGGAATAGGGATGG + Exonic
1173648477 20:44648428-44648450 GTGTCCCGTGGGAATGGGGTGGG - Intronic
1174946384 20:54990647-54990669 GCCTCCCTTGAAGCTAGGGTTGG + Intergenic
1178362674 21:31962483-31962505 GTCTCCTTTGGGACTAACTTTGG - Intronic
1178818570 21:35954069-35954091 GTCTTCCTGGGGATTAGAGTGGG + Intronic
1179022262 21:37651146-37651168 GTGTCACTTGGGAGTAGGGATGG + Intronic
1181043680 22:20204695-20204717 GTCTCCCCTGTGAGTAGAGTCGG + Intergenic
1182972912 22:34594326-34594348 GTCTCCCTTGGGCCCTGGCTAGG + Intergenic
1184164912 22:42721195-42721217 GTCACCCCTGGGACCCGGGTCGG + Intronic
953983888 3:47426879-47426901 GTCTCTCTTGAGCCTAGGGCAGG - Intronic
955854926 3:63262664-63262686 GTCTTCTGTGGGACTAGGGCTGG - Intronic
961349050 3:126287501-126287523 GTCTCCCTCGGGCCTGGGGGTGG - Intergenic
961448837 3:126993337-126993359 GTCCTCCTTGGGACTAGGGGTGG - Intronic
963747809 3:149142929-149142951 GACTCACTTGGGAATAGGGTTGG + Intronic
963943086 3:151115059-151115081 GTCTCCCTTGGAATTGGAGTTGG + Intronic
967221115 3:187248911-187248933 GTCCCCCTTGGGACAATGGCAGG + Intronic
969081146 4:4619205-4619227 GTCTCCCTTTGAATTTGGGTAGG - Intergenic
972702622 4:41508631-41508653 GTCTCCCCTGGGTCATGGGTGGG + Intronic
975351379 4:73351126-73351148 GGCTCCCTTGGATCTAGGTTTGG + Intergenic
975406874 4:73999826-73999848 GGCTCACTGGGGACTAGAGTAGG - Intergenic
982414121 4:155111498-155111520 GTCTCAGTTGGCACTAGAGTGGG + Intergenic
982470871 4:155788478-155788500 GTCACCCATGTGACTAGGTTGGG + Intronic
993729831 5:91409497-91409519 GTCTGCCTTGGGAGCAGGGCAGG + Intergenic
996610298 5:125371012-125371034 GTTTCCCTTGGGACTGGGGGTGG + Intergenic
997432205 5:133848290-133848312 GTTTCCCTTGGGAATGGGGAAGG - Intergenic
997480889 5:134183810-134183832 GACTGCCTTGGGTCTAGGGTAGG + Intronic
1001880546 5:175240384-175240406 GGCTCCTTTGGGAATGGGGTAGG + Intergenic
1004034539 6:11910465-11910487 TTGACCCTTGGGACTAGGATTGG + Intergenic
1004252418 6:14033282-14033304 GGCCCCCTTGGGTATAGGGTGGG - Intergenic
1007241093 6:40425666-40425688 GTTTCCTTTGTGACTAGGGAGGG - Intronic
1007265336 6:40591400-40591422 GAGTCCCTTGGGCCTAGGGGAGG - Intergenic
1007743184 6:44025155-44025177 GGCTCCTTTGCAACTAGGGTGGG - Intergenic
1008833678 6:55801148-55801170 GTATCGTTTGGGATTAGGGTTGG + Intronic
1010573539 6:77506510-77506532 GTATTCCTTGGCACTAGGGGTGG + Intergenic
1012984743 6:105863846-105863868 GTCTGTCTGGGGACAAGGGTAGG - Intergenic
1014205627 6:118651991-118652013 GCCTCCCTTGGAATTAGGATTGG + Intronic
1015480181 6:133700159-133700181 ATCTCCTTTGGGAATAGGGATGG + Intergenic
1016228464 6:141771888-141771910 GTCTCCCCTCGGTCCAGGGTAGG + Intergenic
1018461825 6:164005795-164005817 GTCTCCATGAGGACCAGGGTTGG + Intergenic
1023459771 7:40383677-40383699 GTGTCCATTGGGACTAAGTTTGG + Intronic
1023940090 7:44763693-44763715 GTCACCCTTGGGGGTAGGGCAGG - Intronic
1024604189 7:51011289-51011311 GTCTCCCATGGGACGTGGCTGGG + Intergenic
1026534644 7:71229735-71229757 GTCTCAGATGGGACTAGGGCTGG - Intronic
1028106925 7:86889375-86889397 GTATCCCCTGGGAATAGGGTGGG - Intronic
1029113250 7:98223980-98224002 GTCTCCCTGGGGAAGGGGGTCGG + Intronic
1030715612 7:112803709-112803731 ACCTCTCTTGGGACAAGGGTAGG - Intergenic
1031084357 7:117287575-117287597 GTCTCCCCAGGGACAGGGGTTGG + Intronic
1034271545 7:149805588-149805610 TTCTCCCTTGGGCCCAGGGGTGG + Intergenic
1038536362 8:28355977-28355999 TTCTTCCCTGGGAGTAGGGTAGG + Intronic
1039202091 8:35106489-35106511 GTGTCTCTTGGTAGTAGGGTTGG + Intergenic
1045061447 8:98414691-98414713 GCCTCCCTTGCAACTAGGATTGG + Intronic
1049457502 8:142700976-142700998 TTCTCCCTTGGGTCTGGGTTGGG - Intronic
1049782097 8:144433810-144433832 GTCCCCCTTGGGGCTTGGCTTGG + Intronic
1051290645 9:15542292-15542314 GGCTCCCTTGTAGCTAGGGTTGG - Intergenic
1052982050 9:34457321-34457343 GTCTCCCTTAGGCCTAGCCTCGG + Intronic
1057500842 9:95595794-95595816 GCCTCCCTTAAGTCTAGGGTGGG + Intergenic
1058977004 9:110134156-110134178 GTCTCCCTTAGGACTACAGGTGG - Intronic
1059815468 9:117908185-117908207 GTCTACCTTGGGTCTTGGGGAGG - Intergenic
1061504225 9:131022021-131022043 GCTTCCCTTGGGCGTAGGGTGGG + Intronic
1186532563 X:10311997-10312019 TTCTCCTTTTGGACAAGGGTAGG - Intergenic
1188434165 X:30141359-30141381 CTCTCCCTTGTGGCTAGGGTTGG - Intergenic
1193087212 X:77457565-77457587 CTCTCCTTTGGGACTTGGTTAGG + Intergenic
1198311364 X:135427558-135427580 ATTTCCCTTGGGAGTGGGGTGGG - Intergenic
1198747735 X:139907249-139907271 GTCTCCCTTGTGGCTAGGGAGGG + Intronic