ID: 1088594724

View in Genome Browser
Species Human (GRCh38)
Location 11:111432260-111432282
Sequence GTTTAAGTGATCCGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088594724 Original CRISPR GTTTAAGTGATCCGGGAGGC AGG (reversed) Intronic
906861923 1:49370040-49370062 GTTTATGTGATGATGGAGGCTGG - Intronic
911770870 1:101740844-101740866 GGTTACCTGAACCGGGAGGCTGG + Intergenic
912600365 1:110925374-110925396 GTTTATGTGACCGTGGAGGCTGG - Intergenic
915734145 1:158074146-158074168 TTTTGAGTGATCAGGGTGGCAGG - Intronic
916242050 1:162650082-162650104 GATTAAGTGATCCAGGAGGAAGG - Intronic
920564581 1:206963344-206963366 ATTTAAGTCATCCAGGAAGCTGG - Intronic
922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG + Intergenic
1062882177 10:988048-988070 GTCTAGGGGATCCGGGAGTCTGG - Exonic
1063648911 10:7913877-7913899 GATTAAGTGATACAGGAGGAGGG + Intronic
1067986702 10:51155660-51155682 GTTTATGTGATTGTGGAGGCTGG + Intronic
1068202925 10:53806930-53806952 TTTTAAGTTGTCCGTGAGGCAGG + Intronic
1069085175 10:64130389-64130411 GTCTCAGTGATCCAGGAGGCAGG + Intergenic
1078550730 11:12278937-12278959 ATGTAAGTGTTCTGGGAGGCAGG + Intronic
1084535211 11:69752448-69752470 GTTAAAGAGATTTGGGAGGCTGG + Intergenic
1088594724 11:111432260-111432282 GTTTAAGTGATCCGGGAGGCAGG - Intronic
1090731368 11:129575644-129575666 GTGGAGGTGAGCCGGGAGGCAGG - Intergenic
1100340842 12:93677911-93677933 GGTTAAGTGACCGGGAAGGCAGG - Exonic
1100757059 12:97763115-97763137 GTTTAAATTAGCTGGGAGGCTGG - Intergenic
1110580587 13:77119274-77119296 GTTTAAATGATGCTGGAGGTGGG + Intronic
1116934539 14:50725389-50725411 GTTTAAGTGGTCCTGGAATCTGG + Intronic
1117805877 14:59490216-59490238 GTTTAAAAGATCCTGGTGGCTGG - Intronic
1125022491 15:34999057-34999079 GATTAAGTGGTCAGGGAGGAAGG + Intergenic
1131750880 15:95506965-95506987 ATTTAAGTGGGCCGGGAGGATGG + Intergenic
1132621868 16:871603-871625 GCTTTAGTGATCCGCAAGGCGGG + Intronic
1134832099 16:17331987-17332009 GTTTAAATAATCCCAGAGGCTGG - Intronic
1135877100 16:26212844-26212866 ATTTATGTGATCGGGGAGGCTGG + Intergenic
1136424583 16:30161116-30161138 GTCTCAGTGACTCGGGAGGCTGG - Intergenic
1137839863 16:51630375-51630397 GTTTAAGGGCTCTGGGAGGCAGG + Intergenic
1143815202 17:9507146-9507168 GTTTCATAGATCCGGGATGCAGG - Intronic
1148198850 17:45734538-45734560 GTTTAAGTCATTCCTGAGGCTGG - Intergenic
1148817167 17:50337330-50337352 GTATATGTGATCCAGAAGGCAGG - Intergenic
1148841161 17:50498258-50498280 GTGTCAGGGATCTGGGAGGCAGG - Intergenic
1149610734 17:57956052-57956074 CTTGAAGTGATCAGGGATGCTGG - Intergenic
1153354821 18:4123221-4123243 GTTTTAGTGACCAGGGAGCCTGG + Intronic
1153878757 18:9402487-9402509 GTTTAAGTGATCAGCGGGCCGGG + Intergenic
1155556123 18:27021117-27021139 GTTCAAGTGAAAGGGGAGGCTGG + Intronic
927244014 2:20942444-20942466 GTTTAAGTGATCAGTGATCCAGG - Intergenic
928894370 2:36243798-36243820 GTTTCAGTGATAAGGAAGGCTGG + Intergenic
946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG + Intronic
1170934046 20:20794596-20794618 ATTCTAGTGATTCGGGAGGCAGG + Intergenic
1173107714 20:40153353-40153375 CTTTAAGTGATCCTAGAGGAAGG - Intergenic
1175317165 20:58056764-58056786 GTTCAAGTGATCCGAGTAGCTGG + Intergenic
1175643278 20:60649392-60649414 GTCCAAGTGATGTGGGAGGCAGG - Intergenic
1184961646 22:47933636-47933658 GTTTATGTGATTATGGAGGCTGG - Intergenic
951770450 3:26250322-26250344 GTTAAAGAAATCAGGGAGGCAGG - Intergenic
961715288 3:128853556-128853578 GTTTTGGTGCTCCGGAAGGCAGG + Intergenic
967510060 3:190300766-190300788 GTTTAAGTGTTCTGGGAAGGAGG - Intergenic
979294777 4:119019052-119019074 GTTTACTTGATGGGGGAGGCTGG + Intronic
982995077 4:162333593-162333615 ATTCAAGTGATTTGGGAGGCTGG - Intergenic
990145729 5:52758168-52758190 GTTTTAGTCATCCCTGAGGCCGG - Intergenic
998105451 5:139466128-139466150 GTTGTAGTGAGCCGAGAGGCAGG - Intergenic
1002107651 5:176888058-176888080 ATTGAAGTGATAGGGGAGGCTGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1022960008 7:35417650-35417672 GTTTCAGTTATCCGCCAGGCTGG - Intergenic
1023765191 7:43504158-43504180 GTTGAAGTCATCCAGGAGGACGG - Intronic
1029059734 7:97785099-97785121 GTTTCAGTGATCCTTGAAGCTGG - Intergenic
1036941843 8:13059241-13059263 CTTTAAGTGATCGGATAGGCAGG + Intergenic
1039515666 8:38131215-38131237 TTTAAAGAGTTCCGGGAGGCAGG - Intronic
1046997467 8:120540269-120540291 GTTTAAGCAATCCTGGAGGTGGG - Intronic
1047222860 8:122932530-122932552 GTTCAAGCGATTCTGGAGGCAGG - Intronic
1047614848 8:126555945-126555967 GTGTATGGGATCCAGGAGGCTGG - Exonic
1049968767 9:802712-802734 GTGTGAGTGAGCCGGGAGGCTGG + Intergenic
1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG + Intronic
1061517375 9:131097469-131097491 GTTTGAGGGAGGCGGGAGGCTGG - Intronic
1188701688 X:33272178-33272200 CTTAAAGGGATCAGGGAGGCTGG - Intronic
1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG + Intronic