ID: 1088598625

View in Genome Browser
Species Human (GRCh38)
Location 11:111457307-111457329
Sequence CCCCATCTCCAGAGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 311}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088598625_1088598637 5 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598637 11:111457335-111457357 ATGGAGGATCCAGTCACAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 164
1088598625_1088598639 22 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598639 11:111457352-111457374 AGGAGGCATCTCGCCCATCCTGG 0: 1
1: 0
2: 0
3: 8
4: 161
1088598625_1088598640 23 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598640 11:111457353-111457375 GGAGGCATCTCGCCCATCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 141
1088598625_1088598642 30 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598642 11:111457360-111457382 TCTCGCCCATCCTGGGAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 129
1088598625_1088598635 2 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598635 11:111457332-111457354 CCCATGGAGGATCCAGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 156
1088598625_1088598641 29 Left 1088598625 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG 0: 1
1: 0
2: 5
3: 37
4: 311
Right 1088598641 11:111457359-111457381 ATCTCGCCCATCCTGGGAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088598625 Original CRISPR CCCCATCTCCAGAGGGGCCA AGG (reversed) Intronic
900079481 1:844857-844879 CCGGCTCTCCACAGGGGCCAGGG + Intergenic
900417118 1:2540368-2540390 CCCCATCTCCACAGATGCCCAGG - Intergenic
900742558 1:4339520-4339542 CCACAGGTCCAGAGGGCCCAGGG + Intergenic
902064780 1:13675841-13675863 CCCCATTTTTAAAGGGGCCAAGG - Intergenic
903216213 1:21844528-21844550 TCCCAGCACCAGTGGGGCCAGGG + Intronic
903370999 1:22836127-22836149 CAGCCTCTCCAGAGGGGCCCCGG + Intronic
903475006 1:23613451-23613473 CCCCATGTCCAGCTGGGCCCAGG - Intronic
906856729 1:49314385-49314407 CCCCATCCCCCAAGAGGCCATGG + Intronic
910203639 1:84725509-84725531 CCCCATCCTCAGAGGGCACAAGG + Intergenic
910349520 1:86279446-86279468 GACCAGCTCCAGAGGGACCAAGG + Intergenic
912693334 1:111821206-111821228 CCCCATCTGCAGAGGTCCTAGGG + Intronic
914914607 1:151811424-151811446 CCCCTCCTCCAGATCGGCCAGGG - Exonic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
916606761 1:166350665-166350687 CCCGATTTCCAGAGAGCCCAGGG - Intergenic
916720599 1:167482424-167482446 CCCCACCCCCACAGAGGCCAGGG - Intronic
919430583 1:197486862-197486884 CCCCATCCCCACAGTGGCCGTGG + Intergenic
920860076 1:209698789-209698811 CTCCATCTCCACTGGGGGCAGGG + Intronic
922169440 1:223142752-223142774 GGCCATCTCCAGCAGGGCCATGG - Intronic
922516056 1:226209213-226209235 CTCCATCTCCAGCGGAGCCGGGG + Intergenic
922874144 1:228926978-228927000 CACCATGTCCACAGGGGTCAGGG - Intergenic
924384788 1:243490718-243490740 CCTCATCTTCAGAGGGTCCTGGG + Intronic
924655468 1:245971284-245971306 CCCCACCTCCAGACAGGCCTTGG - Intronic
1062786934 10:272493-272515 CCCCATCTCCAAACGGGACTCGG - Intergenic
1062816582 10:505580-505602 CCCCATCTCCTGTGGGGTCAGGG - Intronic
1062816612 10:505688-505710 CCCCATCTCCTGTGGCGTCAGGG - Intronic
1062816637 10:505796-505818 CCCCATCTCCTGTGGTGTCAGGG - Intronic
1064319934 10:14295606-14295628 CCCCTTCTCCAGTGGGGACATGG + Intronic
1064577175 10:16758218-16758240 CCCCAGCTACAAAGCGGCCAAGG + Intronic
1066057725 10:31697534-31697556 CCCCATGTCCCCAGGGTCCACGG + Intergenic
1066441166 10:35440336-35440358 CCTCTGCTCCAGAGTGGCCAGGG - Intronic
1067012880 10:42730929-42730951 CCCCAGCTACAAAGGGGGCAAGG - Intergenic
1073148967 10:101298811-101298833 CCCCCTCCCAAAAGGGGCCAGGG - Intergenic
1073462343 10:103673154-103673176 CACCATCTTCAGAGCAGCCAAGG - Intronic
1074820548 10:117175144-117175166 CCCCATCTCTGAAAGGGCCAAGG - Intergenic
1075445284 10:122508790-122508812 CCCCATCTCCGGAGTCCCCAGGG - Intronic
1075716838 10:124560703-124560725 GCCCAACTACAGAGGGGCCTGGG + Intronic
1076139865 10:128070284-128070306 CTGCATCTGCAGAGAGGCCAGGG - Exonic
1076646267 10:131957168-131957190 CTCCATCTCCACAGGGGCACGGG - Intronic
1076646301 10:131957352-131957374 CTCCATCTCCACAGGGCACAGGG - Intronic
1076646402 10:131957763-131957785 CTCCATCTCCACAGGGGCGCGGG - Intronic
1076750448 10:132539492-132539514 CCCCATCTCTGGAGAGACCAGGG + Intronic
1077154411 11:1084993-1085015 TCCCATCCCCAGGGTGGCCAGGG - Intergenic
1077444671 11:2585449-2585471 CCCCATCACCACAGCAGCCAAGG - Intronic
1077803954 11:5571333-5571355 CTCCACCACCATAGGGGCCAGGG + Intronic
1078490555 11:11764123-11764145 CCTCATCTCCAAAGGGCTCATGG - Intergenic
1079134545 11:17768926-17768948 CTCCATCACCAGAGTTGCCAAGG - Intronic
1079412615 11:20203340-20203362 CCTCATCTCCCGAGGGGGTAGGG - Intergenic
1080596310 11:33777028-33777050 CCACCTCTCCAGAGGGGCCTGGG - Intergenic
1081575404 11:44316133-44316155 CCACTTCTCCAGAGCCGCCAGGG + Intergenic
1081610664 11:44561292-44561314 CCCCATCTCCAAGTTGGCCATGG + Intergenic
1083038981 11:59668576-59668598 CCCCACCCCTAGAGGAGCCACGG - Intronic
1083993043 11:66258228-66258250 CCGGATCGCCGGAGGGGCCAGGG + Intronic
1084557557 11:69883915-69883937 CTTCCCCTCCAGAGGGGCCACGG - Intergenic
1087509549 11:99073553-99073575 CCCCATCCCCTGACAGGCCATGG + Intronic
1088598625 11:111457307-111457329 CCCCATCTCCAGAGGGGCCAAGG - Intronic
1089610185 11:119664600-119664622 CCCGAACTCCTGGGGGGCCAGGG - Exonic
1089640764 11:119845736-119845758 CCCCTTCTCCAAATGGGGCATGG + Intergenic
1089933190 11:122335136-122335158 GCCCATCTTCTGAGGGCCCAGGG + Intergenic
1091555779 12:1572544-1572566 CCCCATTCCCAGAGAGGCCGTGG + Intronic
1091627951 12:2137130-2137152 CCACGTCTCCAGTGGGGCCTAGG - Intronic
1091637639 12:2209478-2209500 CCCCAGCTACAGAGCAGCCACGG - Intronic
1091715819 12:2775461-2775483 CACCATCTCCAGACGGTACAGGG - Intergenic
1094742587 12:33306764-33306786 CCACATCTCCATTGTGGCCAGGG + Intergenic
1096214468 12:49791802-49791824 CCCCAGCTCCAGCGGGGCCGTGG + Exonic
1100256087 12:92884596-92884618 CTCCACCACCATAGGGGCCAGGG - Intronic
1104108828 12:125687577-125687599 TCACATGCCCAGAGGGGCCATGG + Intergenic
1105202954 13:18194912-18194934 CCCCCTCTGCAGAGGGGCAGGGG + Intergenic
1105602574 13:21900415-21900437 CCGCACCCCCAGAGGAGCCAAGG - Intergenic
1107159364 13:37208217-37208239 CCCTATCTCCAGAAGAGCAACGG - Intergenic
1107240011 13:38221585-38221607 CCCCACCTCCCTACGGGCCAGGG - Intergenic
1107559173 13:41545071-41545093 CCCTAGATCCAGTGGGGCCAAGG + Intergenic
1107770999 13:43787270-43787292 CCCCCTCTCGGGAGGGGCCGAGG + Intergenic
1108498420 13:51046684-51046706 CCCCAGGCCCAGAGGGGACAAGG - Intergenic
1110089294 13:71424885-71424907 CTCCTTCTCCAGAGGGTCTATGG + Intergenic
1110878218 13:80537483-80537505 CCCCACCCCCAGACAGGCCACGG + Intergenic
1112326922 13:98447730-98447752 TCCCATCTCCTGGGAGGCCAAGG + Intronic
1112365425 13:98752135-98752157 CCCCATCTCCTCTTGGGCCAGGG + Intronic
1113898498 13:113782578-113782600 CCCCATGTCCAGTGAGTCCACGG - Intronic
1114066254 14:19061965-19061987 CCCCCTCTGCAGAGGGGCAGGGG + Intergenic
1114096014 14:19338059-19338081 CCCCCTCTGCAGAGGGGCAGGGG - Intergenic
1115761235 14:36580772-36580794 CCCCATCTCCTTGGGCGCCAGGG - Exonic
1115793559 14:36906987-36907009 CCCAATCTCCATAGAGGGCATGG - Intronic
1116008876 14:39327622-39327644 CCCCACCCCCAGAGAGGCCCCGG + Intronic
1117793135 14:59362091-59362113 TCCCAGCCCCAGAGGGTCCATGG + Intronic
1119662280 14:76460536-76460558 CCCCACCTCCTGAGGGAGCAGGG - Intronic
1121320540 14:92989263-92989285 CCCCATCCCCAGGGAGGCCTGGG + Intronic
1122634224 14:103122757-103122779 CCCCAGCCCCAGAGGGGGAAAGG + Intergenic
1122804129 14:104248101-104248123 CTCCCTCTCCAGAGGTGCCCTGG - Intergenic
1122824263 14:104362107-104362129 AGCCTTCTCCAGATGGGCCAAGG - Intergenic
1123049124 14:105532152-105532174 CCCTCTCACCAGTGGGGCCAGGG + Intergenic
1123971388 15:25511188-25511210 AACCATCTCTAGAGGGGCCAGGG - Intergenic
1124443226 15:29705196-29705218 ACCCATCTCCAGAGACGCAAAGG + Intronic
1125760929 15:42094852-42094874 CCCCAGCTCCACTGGAGCCAGGG + Intergenic
1125919740 15:43518330-43518352 CTCCGTCTCCAGAGTGGCCTCGG - Intronic
1127573822 15:60271214-60271236 CTACATCTCTAGAGAGGCCAGGG + Intergenic
1127968078 15:63938738-63938760 GCCCAGCTCCAGTGGGGCCCTGG - Intronic
1128306376 15:66601468-66601490 CCCCATCAGCAGAGCAGCCAGGG - Intronic
1128687133 15:69695189-69695211 CCTCCTCCCAAGAGGGGCCATGG - Intergenic
1130537643 15:84798576-84798598 CCCCATCCCCAGAGCACCCACGG + Exonic
1131551519 15:93361183-93361205 GCGCATTTCCAGAGGGACCAGGG + Intergenic
1132207378 15:99995458-99995480 CTCCAGCTCCAAAGGGGCCTAGG + Intronic
1132698703 16:1213165-1213187 CCCCATCCTCCAAGGGGCCATGG - Intronic
1132981317 16:2739897-2739919 CCCCAGGTCCAGAGGGGCCCTGG - Intergenic
1133029079 16:3001172-3001194 CCCCCTCCCCGGAGGGCCCAGGG - Intergenic
1136114526 16:28086526-28086548 CTCCACCACCAGAGGTGCCATGG + Intergenic
1136117744 16:28105988-28106010 CCCCATCTCCAGATTGGGAAGGG - Intronic
1138131382 16:54482782-54482804 CCCCACTTCCAGTGGGGCCTGGG + Intergenic
1138353810 16:56362150-56362172 CCCCAGGTCCAGACGGGACAAGG + Exonic
1138496820 16:57413931-57413953 CAGCATCTTCAGTGGGGCCATGG - Exonic
1139489355 16:67278419-67278441 CCCCCTCTCCCCAGGGACCATGG + Exonic
1139923835 16:70475020-70475042 CCCCACCTGCAGAGGTCCCAGGG - Intronic
1140268532 16:73442024-73442046 CCCCTTCTCCAGAGAGACCTGGG + Intergenic
1141132656 16:81445903-81445925 CCTCAGATCCAGATGGGCCAGGG - Intronic
1141134516 16:81456908-81456930 ACCCATCTCCGGAGGAGCCGTGG + Intronic
1141727081 16:85796743-85796765 CCCCACCTCCTGAGGGTCAAAGG + Intronic
1143136666 17:4716199-4716221 CCCCAAGTCCAGGGGGCCCAGGG + Intronic
1145267710 17:21388426-21388448 ACCCACCTCCAGAGGGACTAGGG - Intronic
1146544805 17:33728834-33728856 CCGTATCTACAGAGGAGCCAGGG + Intronic
1146950179 17:36900196-36900218 TCCCACCCCCAGCGGGGCCAGGG + Intergenic
1147178093 17:38669285-38669307 CCGCATCTCCACAGGGACAATGG - Intergenic
1147217858 17:38911409-38911431 CCCGATATCCAGAGAGGCTAAGG - Intronic
1147266580 17:39238009-39238031 CCCCATCTCCAGAGGAGCCCGGG - Intergenic
1147767179 17:42844940-42844962 CCCCCTGTCCAGGTGGGCCAGGG - Exonic
1147894454 17:43741410-43741432 CCCCTTCTCCAGAGGGGTCTAGG + Intergenic
1148071936 17:44913785-44913807 CTCCAGATCCAGACGGGCCAGGG + Exonic
1148782773 17:50130763-50130785 CCCTGTCTCCAGGGGAGCCAAGG - Intergenic
1148793706 17:50187381-50187403 ACCCTTCTCCAGAGAGGCAAAGG + Intronic
1148794837 17:50191979-50192001 CTCTTGCTCCAGAGGGGCCAGGG + Exonic
1148844882 17:50523800-50523822 CCTGATGTCCACAGGGGCCATGG - Intronic
1148899543 17:50865947-50865969 CCCGAGCTCCCGAGGGCCCAGGG + Intronic
1149866843 17:60156000-60156022 CCCCAACACCAGGTGGGCCAGGG - Intronic
1150500528 17:65646794-65646816 CCCCAGCACAACAGGGGCCAGGG + Intronic
1150644199 17:66968089-66968111 CCCCATCTGCAGATGAGCCAGGG + Intronic
1151552416 17:74829793-74829815 CCCCAACTCCAGTGGTGCCTGGG + Intronic
1151555870 17:74846430-74846452 CCTCCTCTGCAGAGTGGCCAGGG + Intronic
1152707345 17:81851467-81851489 CCTCTTCCCCAGAGGGGCAAAGG + Intronic
1152754446 17:82081373-82081395 CGGCAACTCCAGAGGGGGCATGG + Intronic
1152779484 17:82219914-82219936 CCCCAGCTCAAGAGGAGGCAGGG + Intergenic
1152785682 17:82246755-82246777 TCCCATCTCCACAGGGCGCAAGG + Intronic
1155504617 18:26521107-26521129 CCCCATCTCCAGGGAGGACTTGG - Intronic
1159889998 18:73944003-73944025 CATCATCCCCAGAGGGGCCCTGG + Intergenic
1160272863 18:77403618-77403640 CCCCACCTCCAGCAAGGCCAGGG - Intergenic
1160772708 19:840300-840322 CCCGATGTCCACAGGGCCCAGGG - Intergenic
1160821735 19:1062160-1062182 CCCCATCCCCAGCGTGGCCCGGG + Exonic
1160970484 19:1765738-1765760 CCTGATGTCCAGAGAGGCCAGGG + Intronic
1161007464 19:1943756-1943778 CCCCCTCTCCAGATGCCCCAGGG - Intronic
1161155153 19:2728729-2728751 CCCAATGTCCACAGGGCCCAGGG - Intronic
1161296371 19:3522598-3522620 CTCCATGTCCCGAGGAGCCATGG - Intronic
1161358084 19:3830586-3830608 CCCCATCCCCAGCTGGGTCAGGG + Intronic
1161978098 19:7617231-7617253 CCCTATGTGCAGAGGGGCCAAGG - Intronic
1163374318 19:16921126-16921148 ACCTAGCTCCAGAGGGGCCCAGG - Intronic
1163688177 19:18724168-18724190 CACCATCTGCAGAGGGGACGAGG - Intronic
1163702597 19:18793671-18793693 CCACAGCTCCAGTGGGGCCTGGG + Intergenic
1163893867 19:20040377-20040399 CCCAGTCTCCAGAGTTGCCATGG + Intergenic
1164823650 19:31268428-31268450 CCCTATCTCCAAAAGGGCCATGG - Intergenic
1165026488 19:32966359-32966381 ACCCATCTCCAGAGAGACCAAGG - Exonic
1166803029 19:45469606-45469628 CCCCTTCTCCTGAGAGCCCAGGG - Intronic
1167013886 19:46826980-46827002 CTCCATCACCATAGGGGCCAGGG + Intergenic
925924369 2:8659753-8659775 GCCCATCTGCAGAGCTGCCAGGG + Intergenic
926684603 2:15689417-15689439 GCCCATCTCCAGAATGGCGATGG - Intergenic
927492508 2:23529900-23529922 GCCCATGTCCTGAGAGGCCACGG + Intronic
928095222 2:28400563-28400585 TCCCATCCCCAGAGGGGCCCGGG - Intronic
928198100 2:29229187-29229209 GCCCATCTTCAGTGGGGCCTGGG + Intronic
928875069 2:36028463-36028485 CACCATCCCCAGAGGGGCCTTGG - Intergenic
929454324 2:42055313-42055335 CACCTTCTCCAGCTGGGCCAGGG - Exonic
929763514 2:44825547-44825569 CCCCCTCTCAAGAGGAGCCCAGG + Intergenic
930025208 2:47025383-47025405 CCCCAACTCCAAAAGGGTCAGGG - Intronic
930313736 2:49772435-49772457 GACCAACTCCAGAGGGACCAGGG + Intergenic
930990680 2:57650506-57650528 CCTCAATTCCAGAGGGACCATGG - Intergenic
932235043 2:70114184-70114206 CCCCCTCTACAGAAGGGCCAGGG - Intergenic
932270017 2:70401097-70401119 CTCTATCTTCAGAGGGGCCTGGG + Intergenic
932574609 2:72955825-72955847 CCCAATCACCAAAGGGGGCAAGG + Intronic
932702183 2:73999687-73999709 ACCCCTCTGCATAGGGGCCAAGG - Intronic
935279437 2:101504822-101504844 CCCTCTCTCCCGAGTGGCCAGGG + Intergenic
937716613 2:125039521-125039543 CCCATTCTCCACAGTGGCCATGG - Intergenic
938310044 2:130283942-130283964 CACCTTCTCCAGGGGGGTCAGGG - Intergenic
938444875 2:131368427-131368449 CACCTTCTCCAGGGGGGTCAGGG + Intergenic
938483650 2:131682101-131682123 CCCCCTCTGCAGAGGGGCAGGGG + Intergenic
938810429 2:134847613-134847635 CCCCATCCCCCGACAGGCCATGG + Intronic
947139960 2:227011553-227011575 TCCCATCTCCAGAGAGTCCCTGG - Intronic
947493228 2:230613866-230613888 CCCCATTTCCAGAGAGGAGAAGG - Intergenic
947766591 2:232641807-232641829 CCTCAGGTCCAGAGGGGACACGG + Intronic
948075696 2:235163743-235163765 TCCCATCTTCCGAGGTGCCAAGG + Intergenic
948373623 2:237505852-237505874 TCCCACCTCCAGAGGGCCCTGGG - Intronic
948434477 2:237943906-237943928 CCCAAAGTCCAGAGGGGGCAAGG - Intergenic
948662663 2:239516614-239516636 CCCCAGCTCCCGTGAGGCCAAGG - Intergenic
948709937 2:239819214-239819236 CGTCATCTCCAGAGGAGCCAGGG - Intergenic
948711864 2:239830221-239830243 ACCCATCTCCAGCAGGGCCAGGG + Intergenic
948770351 2:240248534-240248556 CCCCATGTCCAGATGAGCCCAGG - Intergenic
948883790 2:240873157-240873179 CCCCATCTCCACCAGGCCCAGGG + Intronic
948930061 2:241126317-241126339 GCCCATCAGCAGAGGAGCCAAGG - Exonic
1169288091 20:4326278-4326300 CCCCTTCTCCAGAATGGCCATGG + Intergenic
1170216607 20:13898277-13898299 TCCCATCTCCAGTGGGGTCAGGG - Intronic
1170719919 20:18867578-18867600 CCCCATCTCCTGACAGGCCCTGG + Intergenic
1171111026 20:22482715-22482737 TCCCACCTTCAGAGGGCCCAAGG + Intergenic
1172107228 20:32524025-32524047 CCCCAACTCCAAAGTGGCCTGGG + Intronic
1172950334 20:38719477-38719499 TCCCATCTCCAGAGGTGTCCAGG - Intergenic
1174558320 20:51412427-51412449 CCCCTTCTCCACACGGGCCAGGG + Intronic
1175253464 20:57623628-57623650 CTTCATCTCCAGATGTGCCATGG - Intergenic
1176166354 20:63676073-63676095 CCCCATCTCCAAAGGGGTGGGGG - Intronic
1176265103 20:64205149-64205171 CTCCATCTGCAGAGTGGGCAGGG - Intronic
1176715005 21:10343093-10343115 CCCCCTCTGCAGAGGGGCAGGGG - Intergenic
1177756031 21:25348715-25348737 CCCCACCTCCAGACAGGCCCCGG - Intergenic
1178127770 21:29534027-29534049 CCCCAACATCAGAGAGGCCATGG - Intronic
1178633310 21:34281133-34281155 CCCCATGTGGAGACGGGCCAAGG - Intergenic
1179184107 21:39070720-39070742 CCCCACCTCCAGACAGGCCCTGG - Intergenic
1180082106 21:45491665-45491687 AACCTTCACCAGAGGGGCCAAGG - Intronic
1180096607 21:45558256-45558278 CCCCAAGTCCAGGTGGGCCACGG + Intergenic
1180148561 21:45935692-45935714 CCAAACCTCCTGAGGGGCCAGGG - Intronic
1180484732 22:15784556-15784578 CCCCCTCTGCAGAGGGGCAGGGG + Intergenic
1180603345 22:17036845-17036867 CCCCCTCTGCAGAGGGGCAGGGG + Intergenic
1180707239 22:17817353-17817375 CACCCCCTCCAGCGGGGCCACGG - Exonic
1181003002 22:19996776-19996798 ACCAATCTCCCCAGGGGCCAGGG + Intronic
1181027976 22:20136468-20136490 CCCTATCCACAGAGGGGCAAAGG + Intronic
1181463531 22:23098847-23098869 GCCCGTCTCCAGCCGGGCCAGGG + Intronic
1181763951 22:25077691-25077713 TCCCATCTCCAGGGAGACCAAGG - Intronic
1182281347 22:29219328-29219350 GCCCAGCTCCAGGGGGCCCATGG - Intronic
1182820137 22:33208725-33208747 CCCCACCACCAGACAGGCCATGG + Intronic
1182972583 22:34591613-34591635 CCCCCTCCCCAAAAGGGCCAGGG - Intergenic
1183530438 22:38350610-38350632 CCCCATCTCCAGAGCTTACAGGG + Intronic
1183541394 22:38431257-38431279 CCCCACCTCTGGAGGGGCCTTGG + Intronic
1184470521 22:44693028-44693050 CCCCATGTCCAGATGGGGAAAGG - Intronic
1184498780 22:44859686-44859708 GCTGAGCTCCAGAGGGGCCAGGG - Intronic
1184500045 22:44865918-44865940 GCTGAGCTCCAGAGGGGCCAGGG + Intergenic
1184919056 22:47592907-47592929 CCCCATCTCCATGGGGGCCCGGG - Intergenic
1185014303 22:48334325-48334347 CCCCACCTCCCGAGGGGCGTGGG + Intergenic
1185153914 22:49182028-49182050 AGCCATCGGCAGAGGGGCCATGG - Intergenic
951791035 3:26484954-26484976 CCCCAACTACAGAAGGGCTATGG + Intergenic
952490356 3:33865316-33865338 CTCCATCTCCAGTGGGGGCTGGG + Exonic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953673225 3:44980014-44980036 CCCCTATTCCAAAGGGGCCAGGG + Intronic
954404907 3:50340272-50340294 CCCTTTCTCAAGAAGGGCCAAGG + Intronic
954442914 3:50531461-50531483 CCCCATCACCAGGGAGGCTAGGG + Intergenic
955114980 3:55989023-55989045 CCCCACCTCCTTAGGGGCCTGGG + Intronic
961270088 3:125681761-125681783 CCCTCTCTCCACTGGGGCCATGG + Intergenic
964588655 3:158336433-158336455 CCCCAGCTCCAGAGGGTCACTGG + Intronic
968472798 4:789772-789794 CCCCATCTGCACAGAGGCCTTGG + Intronic
968480043 4:829219-829241 CCCCAGCCCCAGTGAGGCCAGGG + Intergenic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
968966978 4:3773718-3773740 CCCCGTCTCCAGAGCGCCCGTGG + Intergenic
969080041 4:4611050-4611072 CCCCATCCCCAGAGGTGTGATGG + Intergenic
969447536 4:7253700-7253722 GCCCAGCTCCTGAGGGGCCAGGG + Intronic
969871378 4:10107129-10107151 CCCCATCTCCCTGGGGGCCTGGG + Intronic
970441383 4:16083491-16083513 CACCACCTGCTGAGGGGCCAGGG + Intronic
972279807 4:37590883-37590905 CCCCATCTCCATCGGAGCCATGG - Exonic
975286338 4:72625675-72625697 CCCCATCCCCCGACAGGCCACGG - Intergenic
984194796 4:176646146-176646168 CCCCATCTCCAGAGAGCCATTGG + Intergenic
984657057 4:182329372-182329394 CCCCAGCTCCTGAGGGGCCAAGG - Intronic
984751901 4:183286212-183286234 CCCCATCTCCATAGTGGCCATGG - Intronic
985766103 5:1780276-1780298 CACCATCCCCACAGGAGCCAGGG - Intergenic
985807702 5:2059343-2059365 ACCCATGTCCAGAGGGGCCTAGG - Intergenic
987042285 5:14074292-14074314 CCCCATCTCAGGGGAGGCCAAGG + Intergenic
991474552 5:67005155-67005177 CCCCAGCTCCTGAGGGGCTCAGG - Intronic
991495822 5:67224878-67224900 CCCCATCTCCACACAGGCCCCGG + Intergenic
991544354 5:67765071-67765093 CCTCATCACCACAGGGGCCATGG + Intergenic
993002633 5:82397010-82397032 CCCCATCTCCAGAGCAGCCAGGG - Intergenic
993083901 5:83339461-83339483 CCCCATCTCCTGACAGGCCCTGG - Intronic
996849752 5:127938857-127938879 CCTCATCTCCTGATGTGCCAGGG - Intergenic
998387523 5:141766270-141766292 CCCCATATCCAGGGTGGCCTGGG + Intergenic
998926837 5:147135852-147135874 CCCCATCCCCTGATGGGACACGG + Intergenic
999732208 5:154483123-154483145 CCAGATCTCCAGAGGGGACCTGG + Intergenic
1000107026 5:158069525-158069547 CCCCATCCCCAGAAGGACTAAGG + Intergenic
1000307737 5:160010679-160010701 GCCCATCTCCAGGAGGACCAGGG + Exonic
1001700802 5:173705409-173705431 CCCCTTCTCCAGCGGCCCCACGG - Intergenic
1002374946 5:178782054-178782076 CCCCAGCTCCTGAGAGGTCAGGG - Intergenic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1006296878 6:33173700-33173722 CCCTCTCTCCAGGGGGCCCATGG + Exonic
1006297206 6:33174988-33175010 CCCCTTCCCCAGAGGCTCCAGGG + Intronic
1006391461 6:33761378-33761400 CCCCCACTCCTGAGGGGCCGGGG + Intergenic
1006447172 6:34086150-34086172 CCCCATCTACGGAGGCTCCACGG - Intronic
1006573047 6:35021245-35021267 CCCCACCTCCCGGGGGTCCAAGG - Intronic
1007164163 6:39816793-39816815 ACCCATCTGCAGTGGAGCCAAGG + Intronic
1009801020 6:68536561-68536583 CCCCATCCCCAGACAGGCCCTGG + Intergenic
1010545691 6:77152426-77152448 CAAAATCTCCAGAGTGGCCATGG - Intergenic
1010595782 6:77762184-77762206 CTACATCTGCAGAGGGTCCATGG - Intronic
1011128061 6:84028262-84028284 CCCCAACCCCAGAAGGGCCCAGG + Intergenic
1011706284 6:90004436-90004458 CCCCTTCTCTAGAGGGTACAAGG + Intronic
1016996837 6:149966755-149966777 GCCCATCTCCACAGGGGCCCAGG + Intronic
1017001963 6:150003492-150003514 GCCCATCTCCACAGGGGCCCAGG - Intergenic
1017011679 6:150067915-150067937 GCCCATCTCCACAGGGGCCCAGG - Intronic
1018918677 6:168155275-168155297 CTCCATCTTCTGATGGGCCATGG - Intergenic
1019017109 6:168888026-168888048 CCCCACCCCCAGATGGGCCAGGG - Intergenic
1019051681 6:169188429-169188451 CCCAAGCTGCAGAGTGGCCATGG + Intergenic
1019219558 6:170463321-170463343 ACTCATCTCCAAAGGAGCCAGGG + Intergenic
1019271185 7:150045-150067 CCCCATCTGCAAAGGGGACAGGG - Intergenic
1019427600 7:984781-984803 TCCCAAGTCAAGAGGGGCCAGGG + Intronic
1019477966 7:1253046-1253068 CCTCATCTTCACAGGGGCCTGGG + Intergenic
1019579122 7:1751417-1751439 CCCCCTCTCCCAGGGGGCCAAGG - Intergenic
1021891771 7:25193575-25193597 CCCCATCTCAAGAGGAGGGATGG - Intergenic
1022140190 7:27486996-27487018 GCCCATCTGCAAATGGGCCAGGG + Intergenic
1022533388 7:31080799-31080821 CCCGACCTCCAGAATGGCCAAGG - Intronic
1023480663 7:40630304-40630326 CCCCACTTCCAGAGGGTCAACGG - Intronic
1024272532 7:47653560-47653582 CCCCAAGGCCAGAGGGTCCAAGG - Intergenic
1024594693 7:50922287-50922309 CCTCAACTCCAGGGTGGCCAGGG - Intergenic
1024622585 7:51174998-51175020 CCCCAGCTCCAGAGGATCCCGGG + Intronic
1025035972 7:55592671-55592693 CACCTTCTCCTGGGGGGCCAGGG - Intergenic
1026739066 7:72967110-72967132 CCCCTCCTCCACAGTGGCCAAGG - Intronic
1026790087 7:73325742-73325764 CCCCTCCTCCACAGTGGCCAAGG - Intronic
1027104667 7:75397963-75397985 CCCCTCCTCCACAGTGGCCAAGG + Intronic
1028197127 7:87920234-87920256 CCCCATCCCCACAGTGGCCATGG + Intergenic
1028926742 7:96365914-96365936 CCCCATCTCCTGACAGGCCCTGG + Intergenic
1029110115 7:98209745-98209767 CACAAGCTCCAGAGGGACCAGGG - Intergenic
1029181397 7:98704443-98704465 CCCCTTCTGCAGAGCTGCCAGGG + Intergenic
1030051447 7:105541250-105541272 TCCCAGCTCTAGAGAGGCCAAGG - Intronic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1034522788 7:151632915-151632937 ACCCAGCTCCTGAGCGGCCAGGG - Intronic
1036657046 8:10683440-10683462 CCCCAGCATCAGAGGGGACAAGG + Intronic
1036690423 8:10941390-10941412 CTCCATCTCCACAGGGCCCATGG - Intronic
1037882850 8:22581326-22581348 TCCCTTCTCCAGCTGGGCCACGG + Intronic
1037974616 8:23200643-23200665 CCCCAGCTGCAGAGGAGACAGGG - Intronic
1040890934 8:52314976-52314998 CACCATCTCCAGTGGGGGCCAGG - Intronic
1041618079 8:59931604-59931626 CACCATCTACAGAGGGTCCTGGG - Intergenic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1044967068 8:97584110-97584132 TCCCATCCCCACAGAGGCCAGGG - Intergenic
1046407424 8:113791531-113791553 CAGCAGCTCCAGATGGGCCACGG + Intergenic
1047520844 8:125594333-125594355 CCCCATCTCCGTAGGGAGCATGG + Intergenic
1049188418 8:141271603-141271625 CCCCATTTCAGAAGGGGCCAGGG + Intronic
1049256366 8:141616015-141616037 CCCCATCTCCAATGCTGCCATGG - Intergenic
1049421911 8:142520759-142520781 CCCCATCTGCACAGGGGCTGTGG - Intronic
1049778437 8:144416760-144416782 CCCCAGCTCCAGCGAGACCAGGG + Exonic
1049787384 8:144457499-144457521 CAGCATCTGCAGAGGGGCCTGGG - Intronic
1049985011 9:942142-942164 CCCCATCTCCAAAAAGACCAAGG - Intronic
1050182713 9:2937392-2937414 CTCCTTCTCCAGAGAGACCAGGG + Intergenic
1052787599 9:32844203-32844225 CCCCATCTCAACAGTGGCCCCGG - Intergenic
1053019490 9:34685020-34685042 TTCCATCTCCCAAGGGGCCAGGG - Intergenic
1053459815 9:38259547-38259569 CACCATCTGCAGATGGGCGATGG - Intergenic
1057194946 9:93111630-93111652 CTCTACCTCCAGTGGGGCCAAGG - Intronic
1057204664 9:93164100-93164122 CCCTATCACCAGAGTGTCCAGGG - Intergenic
1057891986 9:98876437-98876459 CCCCATCTGCAAAGGGTCCAGGG - Intergenic
1058194149 9:101953385-101953407 TACCATCTCCAGAGGGCCCTTGG + Intergenic
1059335824 9:113567811-113567833 CACCATCCCAAGAGGGTCCAGGG - Intronic
1059438090 9:114288490-114288512 CCCGATCTCCAGGTGGCCCAGGG - Exonic
1059941912 9:119367895-119367917 CCCTAACTCCAGGGGAGCCATGG + Intronic
1060279397 9:122205910-122205932 GCCTAACTCCAGAGTGGCCAGGG + Intronic
1061454497 9:130687586-130687608 CCCCAACTCCTCAGGGTCCATGG + Intergenic
1061493113 9:130957093-130957115 CCTCCTCTCCTGAGAGGCCAGGG - Intergenic
1062268883 9:135699817-135699839 CCGCATCTCCAAAGTGCCCAAGG - Intergenic
1062501662 9:136854458-136854480 CCCCAGCTCCAGGGGGGCCCTGG - Intronic
1203377248 Un_KI270442v1:385561-385583 CCCCAGTTCCAGAGGAGCCAGGG + Intergenic
1185747190 X:2583246-2583268 CCCCTGCTCCAGAGGGGAGAGGG - Intergenic
1186015417 X:5186339-5186361 CCCCATTTCCAGGGGGGAAATGG - Intergenic
1186409372 X:9332912-9332934 ACCCATCTTCAGAGGGTACAGGG - Intergenic
1188617013 X:32169711-32169733 CCCCTTCTCTAGAGTTGCCATGG + Intronic
1188623763 X:32258650-32258672 CCCCATCCCCTGAGAGGCCCCGG - Intronic
1189057686 X:37715867-37715889 ACCCACCTCCAAATGGGCCAGGG + Intronic
1192340479 X:70259621-70259643 TCCCATCTCCAGGGGGGCCATGG - Exonic
1194773012 X:97927815-97927837 CCCCACCTCCTGACGGGCCCTGG - Intergenic
1195818178 X:108911143-108911165 CTAGATCTCTAGAGGGGCCAGGG - Intergenic
1195894603 X:109733056-109733078 CCCCATTTCCAGAGGGGGACTGG - Intronic
1199675132 X:150182239-150182261 ACCCCTCTCCAGTGGGCCCAGGG - Intergenic
1200065750 X:153503416-153503438 CCCCATCTCCAGATGCACCGAGG + Intronic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic
1201289083 Y:12405177-12405199 ACGCATCTTCAGGGGGGCCAAGG - Intergenic