ID: 1088599133

View in Genome Browser
Species Human (GRCh38)
Location 11:111460133-111460155
Sequence AGGTCCTTTTTCTGGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599133_1088599143 17 Left 1088599133 11:111460133-111460155 CCTTTTTGCCAGAAAAAGGACCT No data
Right 1088599143 11:111460173-111460195 CTGGTTTCTAAAGCCAGTGGTGG No data
1088599133_1088599142 14 Left 1088599133 11:111460133-111460155 CCTTTTTGCCAGAAAAAGGACCT No data
Right 1088599142 11:111460170-111460192 TCTCTGGTTTCTAAAGCCAGTGG 0: 1
1: 0
2: 1
3: 26
4: 250
1088599133_1088599145 23 Left 1088599133 11:111460133-111460155 CCTTTTTGCCAGAAAAAGGACCT No data
Right 1088599145 11:111460179-111460201 TCTAAAGCCAGTGGTGGGCTTGG No data
1088599133_1088599136 -2 Left 1088599133 11:111460133-111460155 CCTTTTTGCCAGAAAAAGGACCT No data
Right 1088599136 11:111460154-111460176 CTGCCTTCCTTCCCCATCTCTGG No data
1088599133_1088599144 18 Left 1088599133 11:111460133-111460155 CCTTTTTGCCAGAAAAAGGACCT No data
Right 1088599144 11:111460174-111460196 TGGTTTCTAAAGCCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599133 Original CRISPR AGGTCCTTTTTCTGGCAAAA AGG (reversed) Intergenic