ID: 1088599138

View in Genome Browser
Species Human (GRCh38)
Location 11:111460161-111460183
Sequence TTAGAAACCAGAGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599138_1088599147 6 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599138_1088599150 27 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599150 11:111460211-111460233 GGTCTAATCCCAATCTCGATTGG No data
1088599138_1088599144 -10 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599144 11:111460174-111460196 TGGTTTCTAAAGCCAGTGGTGGG No data
1088599138_1088599152 29 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599152 11:111460213-111460235 TCTAATCCCAATCTCGATTGGGG No data
1088599138_1088599145 -5 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599145 11:111460179-111460201 TCTAAAGCCAGTGGTGGGCTTGG No data
1088599138_1088599151 28 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599138 Original CRISPR TTAGAAACCAGAGATGGGGA AGG (reversed) Intergenic