ID: 1088599139

View in Genome Browser
Species Human (GRCh38)
Location 11:111460165-111460187
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599139_1088599147 2 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599139_1088599150 23 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599150 11:111460211-111460233 GGTCTAATCCCAATCTCGATTGG No data
1088599139_1088599152 25 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599152 11:111460213-111460235 TCTAATCCCAATCTCGATTGGGG No data
1088599139_1088599151 24 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data
1088599139_1088599145 -9 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599145 11:111460179-111460201 TCTAAAGCCAGTGGTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599139 Original CRISPR GGCTTTAGAAACCAGAGATG GGG (reversed) Intergenic