ID: 1088599141

View in Genome Browser
Species Human (GRCh38)
Location 11:111460167-111460189
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599141_1088599147 0 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599141_1088599152 23 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599152 11:111460213-111460235 TCTAATCCCAATCTCGATTGGGG No data
1088599141_1088599150 21 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599150 11:111460211-111460233 GGTCTAATCCCAATCTCGATTGG No data
1088599141_1088599151 22 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599141 Original CRISPR CTGGCTTTAGAAACCAGAGA TGG (reversed) Intergenic