ID: 1088599146

View in Genome Browser
Species Human (GRCh38)
Location 11:111460186-111460208
Sequence TGGGATGCCAAGCCCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599146_1088599152 4 Left 1088599146 11:111460186-111460208 CCAGTGGTGGGCTTGGCATCCCA No data
Right 1088599152 11:111460213-111460235 TCTAATCCCAATCTCGATTGGGG No data
1088599146_1088599150 2 Left 1088599146 11:111460186-111460208 CCAGTGGTGGGCTTGGCATCCCA No data
Right 1088599150 11:111460211-111460233 GGTCTAATCCCAATCTCGATTGG No data
1088599146_1088599155 24 Left 1088599146 11:111460186-111460208 CCAGTGGTGGGCTTGGCATCCCA No data
Right 1088599155 11:111460233-111460255 GGGCTCAAGCCATAGACCCCTGG No data
1088599146_1088599151 3 Left 1088599146 11:111460186-111460208 CCAGTGGTGGGCTTGGCATCCCA No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599146 Original CRISPR TGGGATGCCAAGCCCACCAC TGG (reversed) Intergenic