ID: 1088599147

View in Genome Browser
Species Human (GRCh38)
Location 11:111460190-111460212
Sequence TGGTGGGCTTGGCATCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599137_1088599147 10 Left 1088599137 11:111460157-111460179 CCTTCCTTCCCCATCTCTGGTTT No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599134_1088599147 26 Left 1088599134 11:111460141-111460163 CCAGAAAAAGGACCTGCCTTCCT No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599140_1088599147 1 Left 1088599140 11:111460166-111460188 CCCATCTCTGGTTTCTAAAGCCA No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599138_1088599147 6 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599139_1088599147 2 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599135_1088599147 14 Left 1088599135 11:111460153-111460175 CCTGCCTTCCTTCCCCATCTCTG No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data
1088599141_1088599147 0 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599147 11:111460190-111460212 TGGTGGGCTTGGCATCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599147 Original CRISPR TGGTGGGCTTGGCATCCCAC AGG Intergenic