ID: 1088599151

View in Genome Browser
Species Human (GRCh38)
Location 11:111460212-111460234
Sequence GTCTAATCCCAATCTCGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088599146_1088599151 3 Left 1088599146 11:111460186-111460208 CCAGTGGTGGGCTTGGCATCCCA No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data
1088599138_1088599151 28 Left 1088599138 11:111460161-111460183 CCTTCCCCATCTCTGGTTTCTAA No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data
1088599139_1088599151 24 Left 1088599139 11:111460165-111460187 CCCCATCTCTGGTTTCTAAAGCC No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data
1088599140_1088599151 23 Left 1088599140 11:111460166-111460188 CCCATCTCTGGTTTCTAAAGCCA No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data
1088599141_1088599151 22 Left 1088599141 11:111460167-111460189 CCATCTCTGGTTTCTAAAGCCAG No data
Right 1088599151 11:111460212-111460234 GTCTAATCCCAATCTCGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088599151 Original CRISPR GTCTAATCCCAATCTCGATT GGG Intergenic