ID: 1088602459

View in Genome Browser
Species Human (GRCh38)
Location 11:111493379-111493401
Sequence CCTACCTTCTGCCCTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088602459_1088602465 27 Left 1088602459 11:111493379-111493401 CCTGCACAAGGGCAGAAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1088602465 11:111493429-111493451 AAATTCTAACTTGATGGTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 188
1088602459_1088602463 21 Left 1088602459 11:111493379-111493401 CCTGCACAAGGGCAGAAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1088602463 11:111493423-111493445 TACCAGAAATTCTAACTTGATGG 0: 1
1: 0
2: 1
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088602459 Original CRISPR CCTACCTTCTGCCCTTGTGC AGG (reversed) Intronic
902145490 1:14395447-14395469 TCTACCTTCTGCCCTGGCGGTGG - Intergenic
902470662 1:16645960-16645982 CCTAGCGTATGCCTTTGTGCAGG + Intergenic
902488141 1:16761500-16761522 CCTAGCGTATGCCTTTGTGCAGG - Intronic
904261534 1:29290504-29290526 CATTCCTCCTGCCCCTGTGCTGG + Intronic
904326727 1:29731366-29731388 CCTGACTTCTGCCTTTGAGCTGG - Intergenic
905369968 1:37477631-37477653 CCTGCCTTCTGTCCTGGGGCAGG + Intronic
906185447 1:43858917-43858939 TCTGCCTTCTGCCCTGATGCAGG + Intronic
906749565 1:48246979-48247001 CCTTCCTTCTTCCCTTATTCAGG + Intronic
911650682 1:100384829-100384851 CCAACCTACTGCTCTTGTGAGGG - Intronic
912129588 1:106585441-106585463 CCTACATCTTTCCCTTGTGCTGG - Intergenic
912470153 1:109901214-109901236 CCTCCCTTCTGTCCTTGTCTTGG + Intergenic
915137237 1:153741351-153741373 CTTACCTTCTGGGCTTGGGCAGG - Exonic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
916762701 1:167831647-167831669 TCTACCTTTTCCCTTTGTGCAGG + Intronic
917120817 1:171643220-171643242 CTTCCCTTCTCCCCCTGTGCAGG + Intronic
917686457 1:177421546-177421568 GGTACCTTCTGCTCATGTGCAGG - Intergenic
918125704 1:181581575-181581597 CCTACCTTCTGTCCCCATGCAGG - Intronic
918221198 1:182438305-182438327 CCCACCCACTGCCCTTGTTCAGG - Intergenic
919149009 1:193671349-193671371 CCTTCCTTCTGGTCTTGTGAAGG + Intergenic
919999300 1:202784581-202784603 TCTACCTTTTGCATTTGTGCAGG - Intronic
921285213 1:213603388-213603410 CCTAACTTCTGCCCATGGCCAGG - Intergenic
1063365617 10:5488588-5488610 CCTCCCTTCTGCCCCTGGGCAGG - Intergenic
1066135211 10:32438937-32438959 CCTACCTTCTACTCCTGTTCAGG + Intergenic
1067243461 10:44516575-44516597 CTCACCTTCTGACCATGTGCCGG + Intergenic
1068949425 10:62762235-62762257 CCTCTCTCCTTCCCTTGTGCTGG - Intergenic
1069030348 10:63589448-63589470 CCTGTCTTCTGATCTTGTGCAGG - Intronic
1069988755 10:72301015-72301037 TCTACCTGCGGCCCTGGTGCGGG + Intergenic
1070761203 10:79025403-79025425 CCAACCCTGTGCCTTTGTGCTGG - Intergenic
1071388075 10:85141812-85141834 TCCACCTGCAGCCCTTGTGCGGG + Intergenic
1075263695 10:120983540-120983562 CCTACCTTCTGAGACTGTGCAGG + Intergenic
1075797549 10:125131412-125131434 CCTCCCTTCTGCCCTTGTTTGGG - Intronic
1076214606 10:128682870-128682892 CCCACCCTCAGCCCTTGTGCTGG - Intergenic
1077366963 11:2165152-2165174 CCTTCCTTCTGGCCTTGAGCAGG - Intronic
1077906576 11:6539208-6539230 TCTACCTCCAGCCCTTGGGCTGG + Exonic
1078854107 11:15192213-15192235 CCTACATTCTGGCCATGGGCTGG + Intronic
1080597520 11:33787474-33787496 CCTGCCTTTTCCCCTTTTGCTGG + Intergenic
1080892589 11:36422334-36422356 CCTTCCTTCTGCCCCTTTACTGG - Intronic
1082166852 11:48960072-48960094 CCTACCTGCTGCCCACATGCGGG + Intergenic
1082254127 11:50013616-50013638 CCTACCTTCGGCCCTCATCCAGG - Intergenic
1082656470 11:55864079-55864101 CCTACCTGCTGCCCACATGCGGG + Intergenic
1084074397 11:66761946-66761968 TCAACCTTCTGCCCTTGCGAGGG + Intronic
1085350531 11:75795503-75795525 CCCACCTCCTGCCCTGGGGCTGG - Intronic
1085740464 11:79074346-79074368 CATTCCTTCTGTCCTTCTGCCGG - Intronic
1086583150 11:88422569-88422591 CCTACCATATGCCATAGTGCCGG + Intergenic
1086916259 11:92533269-92533291 CCTCCCATCTTCCCATGTGCTGG + Intronic
1087120179 11:94565640-94565662 CCTACCTGTTGCCCTTCTGATGG + Intronic
1088602459 11:111493379-111493401 CCTACCTTCTGCCCTTGTGCAGG - Intronic
1089075878 11:115738008-115738030 CTTACATTCTCCCCTGGTGCTGG - Intergenic
1092022087 12:5211077-5211099 CCCACCTTCCGCCTTTCTGCTGG - Intergenic
1095435396 12:42181332-42181354 TCTACTTCCTGCCCTGGTGCTGG + Intronic
1096164651 12:49411822-49411844 AGTACCTTCTGCCATTCTGCTGG + Intronic
1097055797 12:56248387-56248409 CCTTCCTTCTGCCTTTTTGTGGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1098518049 12:71401380-71401402 CTTATGTTCTGCCCTTCTGCTGG - Intronic
1101289240 12:103350690-103350712 CCCACCTTCTACTCTTCTGCAGG + Intronic
1101906847 12:108833320-108833342 TATACCTTCTGCCCTCGTGAAGG - Intronic
1102046291 12:109832313-109832335 CTTACCCTCTGCCCTTGCTCCGG + Intronic
1103341420 12:120223111-120223133 CCTACCCTCTGTCCTCTTGCGGG - Intronic
1104753449 12:131254359-131254381 AGTTCCTTCTGCTCTTGTGCAGG - Intergenic
1105312411 13:19224279-19224301 CCTACCTTCTGCTTTTTTGCAGG - Intergenic
1106760330 13:32861433-32861455 CCTTCCTTCAGCCCTAGAGCTGG - Intergenic
1107230014 13:38097412-38097434 CCTACATTTTTCTCTTGTGCTGG + Intergenic
1108299346 13:49058560-49058582 CTTACCTATTTCCCTTGTGCAGG - Intronic
1112154992 13:96807549-96807571 CCTAACTTCTGGCATTTTGCTGG - Intronic
1113010374 13:105758213-105758235 CATACCTGCTGCCATTGTCCAGG + Intergenic
1115763659 14:36600759-36600781 CCTACCCTTTGCCCATGTCCTGG - Intergenic
1117250268 14:53929701-53929723 CCCTCCTTCTGACGTTGTGCAGG + Intergenic
1121641978 14:95490929-95490951 CATAGCCTCTGCCCTTGAGCGGG - Intergenic
1122370704 14:101227524-101227546 TCTTCCTGCTGCCCTTTTGCAGG - Intergenic
1124554065 15:30709259-30709281 CCCAGATTCTGCCCTAGTGCAGG + Intronic
1124677180 15:31696412-31696434 CCCAGATTCTGCCCTAGTGCAGG - Intronic
1124811335 15:32942002-32942024 CCTACAAGCTGACCTTGTGCAGG + Intronic
1125433037 15:39616557-39616579 CCTAGCTTCTGCTGTTGTTCAGG - Intronic
1125724131 15:41859632-41859654 CCTGGCTTCTGCCCTCCTGCAGG - Intronic
1125832007 15:42723645-42723667 TGTACCTTCAGCCCCTGTGCAGG - Exonic
1131507579 15:93031112-93031134 CCTACTTCCAGCCCTTGTGCGGG + Intergenic
1131558281 15:93418021-93418043 CCTTCCTTCTGCCCCTGGGAGGG - Intergenic
1132576487 16:666700-666722 GCTGCCTTCTGCCCTTGGGATGG + Exonic
1132627971 16:901320-901342 CCCACCCTCTGCCCCTGTGCAGG + Intronic
1132840269 16:1975449-1975471 CCTACCGCCTGCCCATGTCCCGG - Intronic
1132860012 16:2065786-2065808 CCTTCCTCCTGCTCTTGTGGAGG + Intronic
1133935955 16:10269483-10269505 CCTACCTCCCGCCTCTGTGCTGG - Intergenic
1136626588 16:31465664-31465686 CCCACCTTCTGTCCTTGTCCTGG + Intronic
1138650198 16:58455933-58455955 CCTTCCCTCTGCTCCTGTGCTGG - Intergenic
1139468714 16:67167180-67167202 TCTACCTGGTGCCCTTCTGCAGG + Exonic
1141608131 16:85167186-85167208 CCTAGCTCCTGCCCTTGAGAGGG + Intergenic
1143239878 17:5434883-5434905 TCAACCTTCTGCCCTTGCGAGGG + Exonic
1143328400 17:6116806-6116828 CCTACCACCTGCCCCTCTGCAGG - Intronic
1144758749 17:17695215-17695237 CCTACCCTTTGCCCTAGGGCAGG + Intronic
1147452415 17:40513916-40513938 CCCACCTTCTCTCCTTCTGCTGG - Intergenic
1148489137 17:48012118-48012140 CCTCCCTTTTCCCCTTTTGCAGG + Intergenic
1149682250 17:58514614-58514636 CCTCCCTTCTGCACTCGTGCGGG - Intronic
1152294334 17:79457860-79457882 CCTTCTTTCTGCCGTTGTGCTGG - Intronic
1154272149 18:12929590-12929612 CCTTCCCTCTGCACCTGTGCAGG + Intronic
1154500350 18:14992916-14992938 CCCACCGCCTGCCCTTGTGGTGG - Intergenic
1156470612 18:37375361-37375383 CCTAGCTGCTGCCCTGGTACTGG - Intronic
1157284335 18:46367109-46367131 CCTACCGGCTGCCCATCTGCTGG + Intronic
1159310891 18:66707443-66707465 CCACCCTTCTGCCAGTGTGCAGG - Intergenic
1160077441 18:75691791-75691813 CCTACTGTCTCACCTTGTGCAGG + Intergenic
1161578186 19:5066326-5066348 CCCACCCACTGCCCCTGTGCCGG + Intronic
1162100858 19:8337856-8337878 CCCACCTTCACCCCTTTTGCAGG - Exonic
1162987169 19:14278019-14278041 TCCACCTGCTGCCCTGGTGCGGG + Intergenic
1163765877 19:19162961-19162983 CCCACCTTCTGCCCCTTTGGGGG + Intronic
1164144808 19:22505395-22505417 CCCACCTTCTCCCCAGGTGCAGG + Intronic
1164307921 19:24021186-24021208 CCTACCTTCTGCCCTTTCTATGG - Intergenic
1167779568 19:51590416-51590438 CCTGCCTGGTTCCCTTGTGCTGG + Exonic
1202703057 1_KI270713v1_random:2740-2762 CCTAGCGTATGCCTTTGTGCAGG + Intergenic
926350026 2:11985680-11985702 CCCACCTTGTGACCTTGTGCTGG + Intergenic
926714681 2:15914771-15914793 CCAACCTTCTGCACTTCAGCAGG + Intergenic
928317729 2:30258853-30258875 CCTCCCTTCTGCCCTTGTCCGGG - Exonic
928370212 2:30735099-30735121 GCCACCTTCTGCCCCTGTGCTGG - Intronic
930718474 2:54615609-54615631 CCTACCATGTACCCTTGGGCAGG - Intronic
934119678 2:88827518-88827540 CCCACCCTCTGCCATTATGCCGG + Intergenic
934585385 2:95488455-95488477 CCTACCTGCTGCCCACATGCTGG - Intergenic
934594080 2:95588301-95588323 CCTACCTGCTGCCCACATGCTGG + Intergenic
934788703 2:97037381-97037403 CCTACCTGCTGCCCACATGCTGG - Intergenic
935184270 2:100717452-100717474 CCTACGTCTTTCCCTTGTGCTGG + Intergenic
939823288 2:146983258-146983280 ACTATTTTCTGCCTTTGTGCAGG + Intergenic
943637859 2:190326173-190326195 CCATCCTTCAGCCCTTTTGCTGG - Intronic
947635537 2:231679129-231679151 CCTACCCTCTGGCCTTGACCTGG + Intergenic
1170649571 20:18227177-18227199 TCCACCTGCTGCCCTGGTGCTGG + Intergenic
1170848009 20:19978470-19978492 CTTTCCTTTTGCCCATGTGCTGG + Intronic
1171284634 20:23926761-23926783 CCTACCTCCTGCTCTTGCGAGGG + Intergenic
1172230296 20:33331751-33331773 GCTTCCTTATGCTCTTGTGCAGG + Intergenic
1172391217 20:34566696-34566718 CCTACCATGTGACCTTTTGCAGG - Intronic
1172442353 20:34974873-34974895 CCAAGCTCCTGCCCTTGTGCAGG + Intergenic
1172794875 20:37529743-37529765 TTTATCTTCTGTCCTTGTGCTGG + Intergenic
1172937238 20:38629126-38629148 CCTCCCTACTGCCCTTGAGCAGG - Intronic
1173728532 20:45313172-45313194 CCAATCTTCTGTCCCTGTGCCGG - Intronic
1174557540 20:51406608-51406630 CCTACGTTTTCCCCTTCTGCTGG - Intronic
1174716920 20:52768856-52768878 CTTTCCTTCTGCCGTTGTGTGGG - Intergenic
1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG + Intergenic
1176702660 21:10075016-10075038 CCGACCTTCTGCCCTCTTGTAGG + Intergenic
1176707198 21:10125488-10125510 CTTCTCATCTGCCCTTGTGCTGG + Intergenic
1176710225 21:10144861-10144883 CCCACCACCTGCCCTTGTGGTGG + Intergenic
1179568299 21:42262752-42262774 CCTACCGTGTGACCTTGAGCAGG + Intronic
1180746828 22:18095154-18095176 CCACCCTTCAGCCCTGGTGCGGG - Exonic
1184430944 22:44441324-44441346 CCTTCCTCCTGCCCTTGAGGAGG - Intergenic
1185119767 22:48959452-48959474 CCTGCCTTCTGCTCTCCTGCAGG - Intergenic
1185207830 22:49550250-49550272 CCTGCCCTCTGCCCTTGATCTGG - Intronic
949856876 3:8469981-8470003 CATACATTCTGCCTTTGTGGAGG - Intergenic
949954533 3:9256764-9256786 CCTGCATTCTGCCCCTGTGGAGG + Intronic
950025344 3:9816236-9816258 CCGACCCCCTGCCCTTGGGCTGG + Intronic
950099846 3:10350055-10350077 CCCAGCTTCTGGCCTGGTGCTGG + Intronic
950398862 3:12754831-12754853 CCTACCTGCTCCCCATGTCCTGG - Intronic
954298769 3:49688294-49688316 CCTAGCATATGCCTTTGTGCAGG - Intronic
955109015 3:55929313-55929335 CCTTACTTCTGCCATTGTGAGGG - Intronic
955800502 3:62681207-62681229 CCATCCTTCTGCCCTAGGGCAGG + Intronic
959253032 3:103972510-103972532 TCTACCTTCTGCACTGGGGCAGG + Intergenic
961379027 3:126485408-126485430 CACGCCTTCTGCCCATGTGCAGG - Intronic
965437858 3:168674713-168674735 CCTAGCTTCTGGTGTTGTGCTGG + Intergenic
966874703 3:184315263-184315285 CCTAGCTTCTGGCCCAGTGCGGG + Intronic
966912435 3:184566933-184566955 CCTACCACCTGCCCTGGTGGAGG - Intronic
967983190 3:195077742-195077764 CCTGCCAGCTGCCCTTCTGCAGG - Intronic
969654906 4:8491357-8491379 TCCACCTGCTGCCCTGGTGCGGG - Intronic
969685522 4:8671994-8672016 CCTCTCGTCTGCCCTGGTGCAGG - Intergenic
970228307 4:13882418-13882440 CTTACCTTCTCCCCTTTTCCAGG - Intergenic
970884459 4:20971169-20971191 CCTATCTTATGCTCTAGTGCTGG - Intronic
976904172 4:90215894-90215916 CCTACATCCTGACCCTGTGCAGG - Intronic
979755939 4:124339425-124339447 TCTACCTGCAGCCCTGGTGCGGG + Intergenic
980374835 4:131931407-131931429 CCGACCTTCTGCCCTCTTGTAGG + Intergenic
982054113 4:151530321-151530343 CCTACCTACTGCCCTGGTCTCGG - Intronic
983290599 4:165799344-165799366 TCTGCCTGCTGCCCTGGTGCAGG - Intergenic
984171383 4:176363505-176363527 AGTATCTTCTGCCCTTCTGCAGG + Intergenic
985138129 4:186810373-186810395 TTTATCTTCTGCCGTTGTGCAGG + Intergenic
985158394 4:187017636-187017658 CCTACCTGCTTTCCTTTTGCTGG + Intergenic
985957304 5:3275212-3275234 CCTCCCTCCCGACCTTGTGCAGG + Intergenic
987470480 5:18321614-18321636 CCAACCTTCTGACATTGTCCAGG + Intergenic
990315736 5:54581589-54581611 CCTCCCTTCTTCCCTTGTTCTGG + Intergenic
994390412 5:99185909-99185931 CCTACCCTCTGCCAGTGTGCTGG + Intergenic
996221852 5:120942508-120942530 ACTTCCTTCTGCCCTTCTGAAGG - Intergenic
997407223 5:133660455-133660477 CTTACCTGCTGCCCTCCTGCTGG + Intergenic
997638689 5:135434527-135434549 CCCAGCTTGTGCCCTTCTGCAGG - Intergenic
999563022 5:152825815-152825837 CCTACATTCTACCCTGGTTCTGG - Intergenic
1001541907 5:172545523-172545545 CCCACCCTCTGCCCTTGTCTGGG + Intergenic
1003003542 6:2359953-2359975 CCTGCCCTGTGCTCTTGTGCTGG - Intergenic
1003068003 6:2919636-2919658 CTTCCCTGCTGCCCTTGTGGCGG - Intergenic
1005511069 6:26511898-26511920 CCTACCCTCTGCCCCTGTTTGGG - Intergenic
1006604774 6:35248394-35248416 CCCACCATCTGCCCTTATTCTGG - Intronic
1006908389 6:37548166-37548188 CCTCCCTTCTGCCCCTCTCCTGG + Intergenic
1006932033 6:37694393-37694415 CCTAGCTCCTGCTGTTGTGCCGG + Intronic
1007055911 6:38884664-38884686 CCTCTCTTCTGCCTTTCTGCAGG + Intronic
1008196136 6:48523303-48523325 CATACCTTCTGCCTCTGTGTAGG - Intergenic
1008645544 6:53510353-53510375 CCTACCTACCATCCTTGTGCAGG - Intronic
1010771613 6:79838445-79838467 CCTACCTCCTGTCCTTGGGAAGG + Intergenic
1016428121 6:143955826-143955848 CCTGCCCTCTCTCCTTGTGCAGG - Intronic
1017041814 6:150314258-150314280 CCTCCCCTCTCCCCTTCTGCAGG - Intergenic
1019993243 7:4706963-4706985 ACTTCCCTCTACCCTTGTGCAGG + Intronic
1020008344 7:4793902-4793924 TCTACCTGCAGCCCCTGTGCAGG + Intronic
1020307178 7:6844166-6844188 CCTGCCTTCTGCTCTTAGGCTGG + Intergenic
1021751343 7:23803734-23803756 CCTACCCTCTGCCCTTAAGTAGG + Intronic
1022120804 7:27306268-27306290 CCAACCTTGTGACCTTCTGCTGG - Intergenic
1024904689 7:54363040-54363062 CCTTTCTTCTGCCCTTGGTCAGG + Intergenic
1026100967 7:67384300-67384322 CCTCCTTTCTGCCCTTGGGCTGG - Intergenic
1028388190 7:90284108-90284130 CCTACCCTATTCCCTAGTGCAGG - Intronic
1030887498 7:114956214-114956236 ACTGCATTCTGCCCTTGTGTTGG + Intronic
1032417714 7:131749957-131749979 CCTGCCATCTGCCTTTGTGGTGG + Intergenic
1033317429 7:140309317-140309339 CCTGCCTTCTGCCCTTTTGTAGG + Intronic
1034264517 7:149774388-149774410 CCTCCCTTCTGCCCCTTTACGGG + Intergenic
1036947422 8:13107411-13107433 CCTACCTCCTCCCCTTGTACTGG - Intronic
1039098613 8:33915027-33915049 CCTACTTTCAGCCTTTGTGTGGG + Intergenic
1042231537 8:66560097-66560119 CCTGCCTTCTTTCCCTGTGCTGG + Intergenic
1044150352 8:88769428-88769450 CCTCCCTTTTGCCCTTGTGGTGG + Intergenic
1044493322 8:92846782-92846804 CCTTCCTTCCTCCCTTGTGGAGG - Intergenic
1046599071 8:116296739-116296761 CCTACCTCCTGCCATTTTCCAGG - Intergenic
1047338546 8:123958327-123958349 CTTACCCTCTGCCTTTGGGCTGG + Intronic
1047757877 8:127932318-127932340 CCTCCCTTCTGCCCCTCTCCTGG + Intergenic
1051017340 9:12494764-12494786 GCTATCTTCTGCCCTTTTCCTGG + Intergenic
1051172866 9:14337165-14337187 GTTACCTTCTGCACATGTGCAGG - Intronic
1051600709 9:18870457-18870479 TCTACCTGCTGCTCTTTTGCTGG + Intronic
1053639855 9:40061743-40061765 CCGACCTTCTGCCCTCTTGCAGG + Intergenic
1053647198 9:40130559-40130581 CCCACCACCTGCCCTTGTGGTGG + Intergenic
1053758526 9:41333284-41333306 CCCACCACCTGCCCTTGTGGTGG - Intergenic
1053766277 9:41403742-41403764 CCGACCTTCTGCCCTCTTGCAGG - Intergenic
1054320607 9:63658055-63658077 CCGACCTTCTGCCCTCTTGCAGG + Intergenic
1054537380 9:66245611-66245633 CCCACCACCTGCCCTTGTGGTGG - Intergenic
1054544893 9:66314898-66314920 CCGACCTTCTGCCCTCTTGCAGG - Intergenic
1057907121 9:98992066-98992088 TCCACCTGCTGCCCTCGTGCGGG - Intronic
1060220922 9:121763662-121763684 CCCACCCTCTGCCCTGCTGCTGG - Intronic
1060756987 9:126220803-126220825 CCATTTTTCTGCCCTTGTGCTGG - Intergenic
1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG + Intergenic
1062562959 9:137149980-137150002 CCTGCGTTCTGCCCTGGTGAGGG - Intronic
1202787679 9_KI270719v1_random:45124-45146 CCGACCTTCTGCCCTCTTGTAGG + Intergenic
1202791946 9_KI270719v1_random:94363-94385 CTTCTCATCTGCCCTTGTGCTGG + Intergenic
1202794989 9_KI270719v1_random:113856-113878 CCCACCACCTGCCCTTGTGGTGG + Intergenic
1188409952 X:29859427-29859449 CATACCTTCTGCACTTGTAATGG + Intronic
1192085798 X:68096100-68096122 TCTACCTTCTCCCCTGGAGCAGG + Intronic
1192965369 X:76171659-76171681 TCTGACTTCTGCCCTTGTTCAGG + Intergenic
1199861845 X:151808080-151808102 GCTACTTTCAGCCCTTGTGGGGG - Intergenic
1200971609 Y:9158507-9158529 CCTACCTGCCACCCTTATGCAGG - Intergenic
1202139409 Y:21705790-21705812 CCTACCTGCCACCCTTATGCAGG + Intergenic