ID: 1088604216

View in Genome Browser
Species Human (GRCh38)
Location 11:111512806-111512828
Sequence CGGCCCCCGAGGACACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088604216_1088604225 9 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604225 11:111512838-111512860 AGCCATGGTAGGGCGTCCCCCGG No data
1088604216_1088604221 -2 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604221 11:111512827-111512849 CGCTTGCGCCCAGCCATGGTAGG No data
1088604216_1088604229 19 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604229 11:111512848-111512870 GGGCGTCCCCCGGTGAAATGGGG No data
1088604216_1088604219 -6 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604219 11:111512823-111512845 GGGCCGCTTGCGCCCAGCCATGG No data
1088604216_1088604227 17 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604227 11:111512846-111512868 TAGGGCGTCCCCCGGTGAAATGG No data
1088604216_1088604222 -1 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604222 11:111512828-111512850 GCTTGCGCCCAGCCATGGTAGGG No data
1088604216_1088604236 30 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604236 11:111512859-111512881 GGTGAAATGGGGTCCGAGGCGGG No data
1088604216_1088604235 29 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604235 11:111512858-111512880 CGGTGAAATGGGGTCCGAGGCGG No data
1088604216_1088604232 26 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604232 11:111512855-111512877 CCCCGGTGAAATGGGGTCCGAGG No data
1088604216_1088604228 18 Left 1088604216 11:111512806-111512828 CCCGGGGGTGTCCTCGGGGGCCG No data
Right 1088604228 11:111512847-111512869 AGGGCGTCCCCCGGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088604216 Original CRISPR CGGCCCCCGAGGACACCCCC GGG (reversed) Intergenic
No off target data available for this crispr