ID: 1088604250

View in Genome Browser
Species Human (GRCh38)
Location 11:111512909-111512931
Sequence CGTCCGGGAGCTGCAGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088604240_1088604250 3 Left 1088604240 11:111512883-111512905 CCCGACCCCGCGTCGGCGCTGCG No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604243_1088604250 -2 Left 1088604243 11:111512888-111512910 CCCCGCGTCGGCGCTGCGGACCG No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604237_1088604250 14 Left 1088604237 11:111512872-111512894 CCGAGGCGGGCCCCGACCCCGCG No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604233_1088604250 30 Left 1088604233 11:111512856-111512878 CCCGGTGAAATGGGGTCCGAGGC No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604245_1088604250 -4 Left 1088604245 11:111512890-111512912 CCGCGTCGGCGCTGCGGACCGTC No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604241_1088604250 2 Left 1088604241 11:111512884-111512906 CCGACCCCGCGTCGGCGCTGCGG No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604239_1088604250 4 Left 1088604239 11:111512882-111512904 CCCCGACCCCGCGTCGGCGCTGC No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604234_1088604250 29 Left 1088604234 11:111512857-111512879 CCGGTGAAATGGGGTCCGAGGCG No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data
1088604244_1088604250 -3 Left 1088604244 11:111512889-111512911 CCCGCGTCGGCGCTGCGGACCGT No data
Right 1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088604250 Original CRISPR CGTCCGGGAGCTGCAGCCGC GGG Intergenic
No off target data available for this crispr