ID: 1088605545

View in Genome Browser
Species Human (GRCh38)
Location 11:111526787-111526809
Sequence CTGCCCATAATGACTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088605545_1088605547 6 Left 1088605545 11:111526787-111526809 CCTTCTTAAGTCATTATGGGCAG 0: 1
1: 0
2: 1
3: 15
4: 84
Right 1088605547 11:111526816-111526838 AAAGACATATCTGAAAGATGAGG 0: 1
1: 0
2: 3
3: 27
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088605545 Original CRISPR CTGCCCATAATGACTTAAGA AGG (reversed) Intronic
901340812 1:8497343-8497365 CTGCCTATAATCAGTTCAGATGG + Intronic
901956041 1:12786626-12786648 CTGCCCATTAGGACTGAACAGGG + Intergenic
901979421 1:13022696-13022718 CTGCCCATTAGGACTGAACAGGG + Intronic
902002662 1:13206242-13206264 CTGCCCATTAGGACTGAACAGGG - Intergenic
902021895 1:13352006-13352028 CTGCCCATTAGGACTGAACAGGG - Intergenic
902752594 1:18527799-18527821 CTGATGATAATGACCTAAGAAGG + Intergenic
910266225 1:85340686-85340708 GTTCCCATAATGATTTAACAGGG - Intronic
911645773 1:100335962-100335984 TTGCCCAAAATTATTTAAGAAGG - Intergenic
912522662 1:110256591-110256613 CTGACCACAATGACTTAAACAGG + Intronic
912811804 1:112800715-112800737 CTACCCATAATGACTTCATGGGG + Intergenic
919520928 1:198585452-198585474 ATGACCATAATGCCTTTAGATGG - Intergenic
1063854571 10:10234421-10234443 CTGTTCATATTGACTCAAGATGG - Intergenic
1074901331 10:117818611-117818633 CTGCTCATAATGCCTAAGGAAGG - Intergenic
1078823660 11:14906597-14906619 CTGCCCAATATGGCTGAAGAAGG - Intronic
1079212164 11:18471805-18471827 CTACCCAGAATGGCTTATGAAGG + Intronic
1088605545 11:111526787-111526809 CTGCCCATAATGACTTAAGAAGG - Intronic
1097885197 12:64721948-64721970 CTGACAATAATTACTTAAAATGG + Intronic
1098598841 12:72305352-72305374 TTGTCCATAATGACTTAGGCTGG - Intronic
1099808755 12:87553747-87553769 CTGCCCATGATGAGATCAGAGGG + Intergenic
1105524118 13:21159266-21159288 GTGACCATACTGACTAAAGAGGG + Intronic
1108184140 13:47871955-47871977 CTGACCATAATGAAATAATAAGG + Intergenic
1109114298 13:58361345-58361367 CTTCCCATTATTACTTTAGAGGG - Intergenic
1119552054 14:75522191-75522213 CTGCCCATGTTGACAGAAGACGG + Intergenic
1121333887 14:93064961-93064983 CTGCCCATAATGAACTAGCACGG + Intronic
1125254617 15:37748963-37748985 CTTCACAGAATGAGTTAAGAAGG - Intergenic
1125547388 15:40516310-40516332 CTGTCCAGGATGACTAAAGAGGG - Intergenic
1136290106 16:29266592-29266614 CTGCCTATGATGATTTAAGGGGG + Intergenic
1136311082 16:29411076-29411098 CTTCCCATCATGACCTAAGCTGG + Intergenic
1137921556 16:52494166-52494188 CAGCCCATAATGATTTATGATGG - Intronic
1139814979 16:69662286-69662308 CTGCCCAGAATTACTACAGAAGG - Intronic
1142095989 16:88240114-88240136 CTGCCTATGATGATTTAAGGGGG + Intergenic
1150307317 17:64096821-64096843 CTGCACATAATGCTTTAAGTTGG - Intronic
1152608164 17:81303304-81303326 CTGCCTGTCATGACTGAAGAGGG + Intergenic
1154293471 18:13130608-13130630 CTTCCCAGTATGACTTAAGAGGG + Intergenic
1156628497 18:38939214-38939236 ATGCCCATAATATCTTAAGAAGG + Intergenic
1156758580 18:40558790-40558812 CTGCCATTACTGACTGAAGATGG + Intergenic
1164017767 19:21267956-21267978 CTTCCTATTATGACTTAAGATGG + Intronic
1164199795 19:23007818-23007840 CTTCACAGAATGACTTAGGAAGG + Intergenic
1165860086 19:38904793-38904815 CTGCCCAAAATGAAGTAACATGG - Intronic
1167808994 19:51811964-51811986 TTGCCCATATTGTCTTGAGAAGG + Intronic
926323406 2:11764830-11764852 CTGTCCATCATGACAGAAGAAGG + Intronic
927225513 2:20761563-20761585 GTACCCAGAAGGACTTAAGAAGG + Intronic
930074035 2:47392112-47392134 GTGCCCATAATGACTTCAGCTGG - Intergenic
933584011 2:84160542-84160564 CTGCCCAGCATGGCTTAGGAAGG + Intergenic
935897088 2:107749155-107749177 CTGCCCATAATGATTCATGATGG + Intergenic
938211070 2:129466085-129466107 CTGGGCAAAATGACTTATGAAGG - Intergenic
939808572 2:146804964-146804986 ATGTCCAAAATGACTTGAGAGGG + Intergenic
941140035 2:161768773-161768795 CAGCACATAATCACTAAAGATGG - Intronic
941983719 2:171489046-171489068 CTTCCCATAATGAATCAAGGGGG + Intergenic
1169659576 20:7963598-7963620 CTCCCCTAAATAACTTAAGACGG + Intergenic
1171314978 20:24182495-24182517 CTTCCCATAATGAATTTACAAGG + Intergenic
1175421573 20:58838037-58838059 TTCCCCATACTGACTCAAGAAGG + Intergenic
1178917168 21:36712128-36712150 CTGCCAATTATGACATAAAATGG + Intronic
1181599916 22:23944279-23944301 CTACCAAAACTGACTTAAGAAGG + Intergenic
957859274 3:85923474-85923496 CTGCCTATAATGGCAAAAGAAGG - Intronic
958729816 3:97949696-97949718 CTGCCCATATTCACTAAGGATGG + Intronic
958854177 3:99364552-99364574 CTGCCTAAAATCACTTGAGAAGG - Intergenic
960608785 3:119535526-119535548 AGGCCTATAATGGCTTAAGATGG - Intronic
964065710 3:152576524-152576546 CTGGCCATAATGAAATAATAAGG + Intergenic
965423234 3:168488562-168488584 CTGCCTAAAATGACTTTAAAGGG - Intergenic
966139750 3:176742663-176742685 CTGCTCATAATGACTGAAAATGG - Intergenic
966506893 3:180714089-180714111 CTGCCACTAAAGAGTTAAGATGG + Intronic
968841258 4:3007738-3007760 TTGCCCATAACTACCTAAGAGGG + Exonic
969320942 4:6412196-6412218 CTTCTCTTAATGACTTCAGAAGG + Intronic
971554691 4:27998950-27998972 CTTCACAGAATGATTTAAGAAGG + Intergenic
971866415 4:32177815-32177837 CTGCCCAAAGTGACTACAGATGG + Intergenic
972001210 4:34036833-34036855 GTGCTCATAATTACTTCAGAAGG + Intergenic
972460348 4:39296067-39296089 CAGCAAATAATTACTTAAGAGGG + Intronic
972491411 4:39590932-39590954 CTGCCTAAAAGGACTTAAAAAGG - Intronic
974169986 4:58254223-58254245 CTGGCCTAAGTGACTTAAGATGG - Intergenic
974714384 4:65648319-65648341 CTGCTCATAGTGACTTAAGTTGG - Intronic
976833299 4:89340232-89340254 CTGCCCGTAATTACGTATGAGGG + Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
983135944 4:164080864-164080886 TTGCACATAATGATTTAAGAGGG + Intronic
983325650 4:166252502-166252524 CCACCCATAATTACTTAATAAGG + Intergenic
985351132 4:189062326-189062348 CTGCCCATTCTGAATTAAGGAGG - Intergenic
987075553 5:14378928-14378950 CATCCCAAAATGACTTAAGAAGG - Intronic
990492093 5:56312456-56312478 CTGCCCATGAAGCCTTGAGAGGG - Intergenic
992267699 5:75034510-75034532 CTGCCCATAAGCCTTTAAGAGGG - Intergenic
994253170 5:97560999-97561021 CTGCACATAATGACTTCAGTGGG - Intergenic
996491327 5:124101080-124101102 CTGCCAATAATGACTTACAATGG - Intergenic
998417922 5:141958968-141958990 CTGCCCACACTGACTTATGAGGG + Exonic
999826316 5:155276821-155276843 CTGCCAATAATGACGAAAGATGG - Intergenic
1010923675 6:81716797-81716819 CTGCCACTAATTAGTTAAGAGGG - Intronic
1015254049 6:131158327-131158349 CTGCACACAATGCCTTAAGAAGG - Intronic
1016718538 6:147264915-147264937 CAGACCTTAATAACTTAAGAGGG - Intronic
1027388456 7:77681522-77681544 CAGCCCAAACTGACTGAAGATGG - Intergenic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1034690540 7:153010286-153010308 CTCCCCATAATGACTAAAGAGGG - Intergenic
1037406083 8:18544074-18544096 CTGCTCATTTTGTCTTAAGATGG - Intronic
1043709563 8:83398404-83398426 CTTGCAATAATGACTTATGAAGG + Intergenic
1047756227 8:127920492-127920514 ATGCTCATAATCACTTTAGAAGG - Intergenic
1048005925 8:130419314-130419336 CTGCCACTAATTACTTTAGAAGG + Intronic
1050982219 9:12035127-12035149 CTGACCTTGAAGACTTAAGATGG + Intergenic
1051022450 9:12560305-12560327 CTGACCATCAAGACCTAAGAAGG + Intergenic
1057238289 9:93384203-93384225 CTGCCTATAATAAATTAAAAAGG + Intergenic
1059891957 9:118813773-118813795 CTGCCCATAATGTCCAAAAATGG - Intergenic
1059975498 9:119712449-119712471 AGGACCATAATGACTTCAGAAGG - Intergenic
1189962387 X:46336496-46336518 CTTCACAGAATGAATTAAGAGGG - Intergenic
1197398857 X:125963897-125963919 CTTCATATAATGAGTTAAGAAGG - Intergenic
1201484692 Y:14480131-14480153 CTGCTGAGAATGACCTAAGATGG - Intergenic