ID: 1088606007

View in Genome Browser
Species Human (GRCh38)
Location 11:111532897-111532919
Sequence CTGGTGTATTTGAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088606007_1088606008 -5 Left 1088606007 11:111532897-111532919 CCTTTTTTTCTCAAATACACCAG 0: 1
1: 0
2: 2
3: 31
4: 342
Right 1088606008 11:111532915-111532937 ACCAGATGTGATTTTCCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088606007 Original CRISPR CTGGTGTATTTGAGAAAAAA AGG (reversed) Intronic
902354316 1:15886081-15886103 ATGCTGTATTTGACCAAAAAAGG - Intronic
905177058 1:36143397-36143419 CTGGTGTGTTTGAGAAACAGCGG + Intronic
907363928 1:53945005-53945027 GTGGTGTACTTTAGAAAACACGG + Intronic
907511577 1:54965292-54965314 GTGGTGTGTTTAAGAAAAAAGGG + Intergenic
909474780 1:76070560-76070582 TTGGTTCATTTGAAAAAAAATGG + Intergenic
911027596 1:93450864-93450886 ATGTTAAATTTGAGAAAAAAAGG + Intronic
911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG + Intergenic
911335578 1:96576321-96576343 CTGGTGCATTTGAGGAAGACTGG - Intergenic
911484253 1:98485841-98485863 CTTCTGTATTTAAAAAAAAAAGG + Intergenic
911675426 1:100653455-100653477 CTGGTGAAGTTGGGAGAAAAAGG + Intergenic
912589511 1:110802169-110802191 CTCACGTATTTGTGAAAAAACGG - Intergenic
914673386 1:149888940-149888962 CTGGTGCATTTCAGGAAAAGAGG - Intronic
915247283 1:154565397-154565419 CTGGGGGATTTGAGAAGAGAAGG + Intergenic
915717820 1:157961193-157961215 ATGGAGTATTAGAGAAAAAGAGG + Intergenic
917003596 1:170387261-170387283 CTGGTGAAGTTGTGAAGAAAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917513275 1:175685825-175685847 ATGGTTTGTTTGAGTAAAAAAGG - Intronic
918728605 1:187959575-187959597 CAATTGTATTTGAGAAAAGAGGG + Intergenic
919200912 1:194354265-194354287 CTGGGTTATATGAGAACAAAAGG + Intergenic
919394902 1:197033865-197033887 CTGAGGTATTTGAGAGAATAAGG + Intergenic
919394915 1:197034222-197034244 CTGATTCCTTTGAGAAAAAATGG - Intergenic
919797241 1:201328328-201328350 CTCCTGTGTTTGAGAAACAATGG + Intronic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921181025 1:212631178-212631200 CTGGGCTCTTTGAGAACAAAAGG + Intergenic
921455938 1:215371599-215371621 TTGGTGGATCTGAGAAAAAATGG - Intergenic
921831680 1:219734115-219734137 TTGGTGTATTTAAGAAAAGGGGG + Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923795932 1:237155468-237155490 GTGGCGTATTTAAGAAAGAAAGG + Intronic
1063792331 10:9466484-9466506 CTGGTCAATTTGTGAGAAAATGG - Intergenic
1063939673 10:11114629-11114651 ATGGTGAATTTGAGAATGAAAGG + Intronic
1064268247 10:13842302-13842324 CTCATTTATTTGAGACAAAAGGG - Intronic
1064858597 10:19799176-19799198 CTGGTTGATTTAGGAAAAAAAGG + Intergenic
1066487051 10:35856207-35856229 TTGATGTATTGGGGAAAAAAGGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1068782605 10:60937722-60937744 CTGTTGTGTTCAAGAAAAAAAGG + Intronic
1068897308 10:62220267-62220289 CTGCTATATTTTAGAAATAAGGG + Intronic
1069512677 10:69053890-69053912 CTGGGGAATTTTAGAAAACATGG + Intergenic
1071151104 10:82635563-82635585 CTTTTGTCTATGAGAAAAAATGG - Intronic
1071151115 10:82635742-82635764 CTGCATTATTTGAGAAGAAAAGG - Intronic
1074172697 10:110958898-110958920 CTGATGTACTTGAGAACAATTGG - Intronic
1076503453 10:130955219-130955241 CTGGTGTATTTGAAACAAGCAGG - Intergenic
1077767267 11:5172716-5172738 CGGGTGTATTAGAGAGAAAGGGG + Intronic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079666199 11:23109056-23109078 CTGGAGAAGTGGAGAAAAAAAGG + Intergenic
1081063248 11:38505694-38505716 CTGGTGGCTATGAGAGAAAATGG + Intergenic
1081670816 11:44941543-44941565 CAGGTGTAGTTGGGAAAATAAGG + Intronic
1081847006 11:46247950-46247972 CAGGTGTATTGGAGAAAGACGGG + Intergenic
1081857543 11:46313095-46313117 CAGGTGTAGGTGAGGAAAAATGG - Intronic
1082014471 11:47474269-47474291 CTGATGTGTTTGAAAAAAACAGG - Intronic
1087745025 11:101934092-101934114 CTGGAGGATTTTAGAGAAAAGGG - Intronic
1088011915 11:105014006-105014028 TTGGTGTAATTCAGAAAGAAAGG - Intronic
1088470148 11:110181760-110181782 CTGGTGTATGTGTGATAACATGG - Intronic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1089530105 11:119122092-119122114 CTGTGGTATTCAAGAAAAAAAGG - Intronic
1089787049 11:120915210-120915232 CAGGTGTACTTGAAAATAAAGGG + Intronic
1090168841 11:124580466-124580488 CCGGTTTATTTTAGAAAAAATGG + Intergenic
1090594651 11:128308192-128308214 CTGGATTATCTGAGAAGAAAAGG - Intergenic
1092980289 12:13787940-13787962 CTGGTGTATTTGAGATAAGTTGG - Intronic
1093045584 12:14440442-14440464 CTGGTGGATATTAGAAAAAGTGG - Intronic
1093576469 12:20736460-20736482 CTTGTGAATTTGAGTAAGAAAGG + Intronic
1093587058 12:20850939-20850961 CTGGTGAAGTTGTGAAGAAAAGG - Intronic
1093804328 12:23413503-23413525 TTGGTGTATTTGAAAAAATGTGG - Intergenic
1094433857 12:30399389-30399411 CTGGTGGATCAGAGATAAAAGGG + Intergenic
1095155269 12:38845285-38845307 CTGGTGTGTTAGAGAACAAAAGG - Intronic
1096534301 12:52261327-52261349 CTGGTATATTGGTGATAAAAGGG - Intronic
1097994180 12:65869574-65869596 CTTATGTATTTAAGAAAGAATGG + Intronic
1098694508 12:73536161-73536183 GTGGTGTGTGTGAGAAGAAATGG - Intergenic
1098695309 12:73546033-73546055 CTGTTAAATTTTAGAAAAAAAGG - Intergenic
1098903593 12:76138490-76138512 CTGGTGGATGTGGGAAAAATTGG + Intergenic
1100977573 12:100138303-100138325 CTGATCTATTTAAGTAAAAAGGG - Intronic
1102270412 12:111529972-111529994 CTGATTTAGTTGAGAAGAAATGG - Intronic
1102746034 12:115249993-115250015 CTGGATTATTTGATCAAAAAGGG - Intergenic
1103155379 12:118680297-118680319 ATGGGGTATTTTTGAAAAAATGG - Intergenic
1104537319 12:129630231-129630253 CGTGTGTGTTTGAGAAAAACAGG + Intronic
1107313695 13:39107834-39107856 CTGGTGAATTTAATAGAAAATGG + Intergenic
1107817364 13:44256134-44256156 CTGATGGATATGAGACAAAATGG - Intergenic
1108272264 13:48773038-48773060 CGGGTTTCTTTTAGAAAAAATGG + Intergenic
1108699528 13:52932108-52932130 CTGGTTTGTTTTAGAAAAACAGG - Intergenic
1108782761 13:53856829-53856851 CTATTGTATTTCAGAAAAAAAGG - Intergenic
1109096299 13:58121099-58121121 CTGGAGTAATTTAGAAAAAAAGG + Intergenic
1110118938 13:71857312-71857334 CTGTTGTATTTCAGTAAAATAGG + Intronic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1110221215 13:73076014-73076036 TTTGTATATTTGAGAAAACAGGG + Exonic
1111751651 13:92339378-92339400 CTTGTGTATTTGAGTAATCAAGG + Intronic
1112061803 13:95748027-95748049 ATGTTGGATTTGAGATAAAAGGG - Intronic
1112503978 13:99963664-99963686 ATGGTTTATTTAAAAAAAAAAGG - Exonic
1112659444 13:101490827-101490849 CTGGTTCATTTGAGAAATCATGG + Intronic
1112941682 13:104870351-104870373 CTTGTGTAATTGAGAAAAACAGG - Intergenic
1113334014 13:109360823-109360845 CTGTTGATTTTGGGAAAAAAGGG + Intergenic
1113377641 13:109780640-109780662 CTGGTCTATTTAAGAACAAAAGG + Intronic
1113846750 13:113396148-113396170 CTGGGGAATTTGAGCAGAAAGGG + Intergenic
1114177811 14:20339185-20339207 CTGGTATGTTTGAGACAAAGTGG + Intergenic
1115053407 14:29092528-29092550 CAGGTTTATTTGAGCAAAATCGG + Intergenic
1115463754 14:33690653-33690675 CTCTTGTATTTGAGAAACTAGGG - Intronic
1115772827 14:36684271-36684293 CTTGTTTACTTGAGAAAAAGAGG + Intronic
1115883673 14:37947743-37947765 CTGGTGAAGTTGTGAAGAAAAGG + Intronic
1116279267 14:42881233-42881255 TTGCTGTATTTTAGAAATAAAGG + Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1117881001 14:60313469-60313491 GTGGTGTTGTTGAGAAACAAGGG - Intergenic
1118151005 14:63190367-63190389 CTGGTCTAGTTGAGAGATAATGG - Intergenic
1118467201 14:66041806-66041828 CTGGTTTATTTAAGAACAAAGGG + Intergenic
1119409126 14:74418258-74418280 TTGCTGCATTTGAGAATAAAGGG + Intronic
1120159645 14:81131577-81131599 CTGGTATATTTGAGGAAGCAAGG - Intronic
1121322830 14:93002541-93002563 CTGGGGCATTTCAGGAAAAAGGG + Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1125229685 15:37439078-37439100 AGAGTGTTTTTGAGAAAAAAGGG + Intergenic
1125634038 15:41172300-41172322 CTGGTTCATTTGGGAAAAAGAGG + Intergenic
1126296352 15:47140684-47140706 CTGGTTCTTTTGAGATAAAAGGG + Intergenic
1126812546 15:52422515-52422537 ATGGGGTATTTGAGAAAAAGAGG - Intronic
1127550815 15:60036728-60036750 CTGGTGTAAAAGATAAAAAATGG - Intronic
1127805032 15:62511412-62511434 CAAGTATTTTTGAGAAAAAAAGG - Intronic
1129043609 15:72712176-72712198 CAGGTGTCTTTAAGAAAAAGTGG - Intronic
1131283512 15:91039627-91039649 CTGGTCCATTTGAGGAAAGATGG - Intergenic
1131304102 15:91226085-91226107 CTGGTTGATTTGAGAGATAAAGG + Exonic
1131527601 15:93165092-93165114 CAGGTGTATTAGTGAACAAATGG + Intergenic
1132013864 15:98299306-98299328 ATTTTGTAATTGAGAAAAAAGGG - Intergenic
1132136771 15:99349301-99349323 TTGGTGTACTGGAGTAAAAATGG + Intronic
1134192040 16:12129256-12129278 CTGGTGTAGCTGTGACAAAATGG + Intronic
1135609033 16:23848674-23848696 TTGGTGTTTTGGAGAAAGAAAGG + Intronic
1139065946 16:63314866-63314888 CTGGTGTCATAGAGAAAGAAGGG - Intergenic
1139134129 16:64180791-64180813 CTGGTGTCATAGAGAAAGAAGGG - Intergenic
1142844900 17:2666041-2666063 CTGGTCTTTTGGAAAAAAAATGG + Exonic
1143613514 17:8035106-8035128 CAGGTTTAATTGAGATAAAACGG + Intergenic
1143699010 17:8643829-8643851 CTGGTGAATTTGCGGAGAAAGGG - Intergenic
1146099837 17:29970453-29970475 CTTGTCTACTTGAAAAAAAATGG + Intronic
1148529501 17:48376007-48376029 CTTGTGTATTGGAGAAAACAAGG + Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1153472235 18:5459800-5459822 ATAGTTTATTTTAGAAAAAAAGG - Intronic
1153741456 18:8133704-8133726 TTGGTGTATTTCAGAAAGGAGGG + Intronic
1153813005 18:8768245-8768267 TTGGTGCATTTGAAAATAAATGG + Intronic
1154069575 18:11141276-11141298 GTGGTGTATTTAAGGAAGAATGG + Intronic
1157076101 18:44469346-44469368 CTGGTGAATAAGTGAAAAAATGG + Intergenic
1157211380 18:45745416-45745438 CTGGTGCATCTAAGGAAAAAGGG + Intronic
1157627312 18:49061403-49061425 CCGGTGTGTTTGAGAATAAGAGG + Intronic
1157736540 18:50054542-50054564 CTGGTGCATTTCACAAATAATGG - Intronic
1157777919 18:50411013-50411035 CTGGTGAAGTTGGGAAAGAAGGG + Intergenic
1157948668 18:52009889-52009911 CTGGTTTATTTGAGGCAAAATGG - Intergenic
1158803436 18:60941396-60941418 GTGCTGTAGTTTAGAAAAAAAGG - Intergenic
1158881896 18:61787722-61787744 CTGGTGAAGATGTGAAAAAAAGG - Intergenic
1159492438 18:69154727-69154749 TTGATGTATTTCAGAAAAAGAGG + Intergenic
1160187839 18:76689079-76689101 CTGGCGTATTTGGGAATCAAAGG + Intergenic
1162569115 19:11460579-11460601 CTGGTGTGTTTGGGAAAAATGGG - Intronic
1163854778 19:19692751-19692773 CTGGTATATTTAAGAAAAACAGG + Intergenic
1164924866 19:32122703-32122725 CTGGTGCATTTGAGACATAGAGG - Intergenic
1164952369 19:32347531-32347553 TTGGTGTATTAGAGAAAGCATGG + Intronic
1166441735 19:42821624-42821646 CTGGTGTATTCCAAAAAGAACGG + Intronic
1166449867 19:42889604-42889626 CTGGTGTATTCCAAAAAGAACGG + Intronic
1166478461 19:43149889-43149911 CTGGTGTATTCCAAAAAGAATGG + Intronic
1166501118 19:43342196-43342218 CTGGTGTATTCCAAAAAGAACGG + Intergenic
1166964321 19:46518930-46518952 CTGGTGTCTTTATGAGAAAAGGG - Intronic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
925584691 2:5452848-5452870 CTTTAGAATTTGAGAAAAAAAGG - Intergenic
926254688 2:11181108-11181130 CTGAAATATTTGAGTAAAAAAGG - Exonic
926972506 2:18480957-18480979 CTGAGGAATTTGAGAAAAGAGGG + Intergenic
927161966 2:20272434-20272456 CCAGTGTATATGAGAAAAACAGG - Intronic
927301305 2:21518963-21518985 CTGATTTACTTGAGAAATAAAGG - Intergenic
927951628 2:27173917-27173939 CTGGTGTTTTTGAAATAGAAGGG - Intergenic
929463897 2:42127613-42127635 GTGGTTTTTTTGAAAAAAAAAGG - Intergenic
930369598 2:50486524-50486546 CTGTTGTGTTAGAGAAAGAATGG + Intronic
931155089 2:59619040-59619062 TAGGTATATCTGAGAAAAAATGG + Intergenic
931496881 2:62817415-62817437 CTGGTGCATTGGAGAAAGTAAGG + Intronic
932248274 2:70216862-70216884 TAGGTGTATTGGAGAAGAAAAGG - Intronic
932539166 2:72633498-72633520 CTGGTGTAATTAAAACAAAATGG + Intronic
933982777 2:87566905-87566927 CTGGTGTTTTGGGGAAAAAATGG - Intergenic
934095493 2:88598842-88598864 CTGATGTATTTAAGAGTAAAGGG + Intronic
935192952 2:100793157-100793179 CTAGCTTATTTGGGAAAAAAGGG - Intergenic
935612499 2:105039553-105039575 CAGGTGTACTTTACAAAAAATGG + Intronic
935933085 2:108151230-108151252 CTGGTCTCTTTAAGAAAGAAAGG + Intergenic
937642894 2:124233894-124233916 CTGGTGTTTTTGAGTTTAAAAGG - Intronic
938366905 2:130741785-130741807 CTGGCATATCTGAGAAATAATGG + Intergenic
938629848 2:133154793-133154815 GTGGTCTATTTGAGAAATTAAGG + Intronic
938919075 2:135976035-135976057 CTTGAGTATTTAACAAAAAATGG + Intronic
939322584 2:140643156-140643178 TTTCTGTATTTAAGAAAAAAGGG - Intronic
939440048 2:142236020-142236042 CTGGAAAATTTCAGAAAAAATGG + Intergenic
940284609 2:152021078-152021100 GTGGTGTATTTTAGTAGAAACGG - Intronic
941096929 2:161247805-161247827 CTGGGGTATATGAAAAATAATGG - Intergenic
942464544 2:176194124-176194146 CTGATGTATTTTGGAAAGAAGGG + Intergenic
942845839 2:180424163-180424185 CTGGGGTATATATGAAAAAAAGG - Intergenic
942955806 2:181772098-181772120 CTGGTGGTTTCTAGAAAAAAGGG - Intergenic
943003132 2:182355122-182355144 CTTGTGTATATGAGAAAGATTGG - Intronic
943081052 2:183259671-183259693 CTGTTGTATTTTAAAATAAAAGG + Intergenic
943319270 2:186427467-186427489 ATGGTGGGTATGAGAAAAAAAGG + Intergenic
943600981 2:189920698-189920720 CTGGAGAATTTGAACAAAAAAGG - Intronic
943708964 2:191067875-191067897 CTTGTGTAATTGTGAAAAAGAGG + Intronic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
944785061 2:203061842-203061864 CTGGTGCATTTGAAATAAACTGG + Intronic
945096520 2:206224361-206224383 CTGTTTTAATTGAAAAAAAAAGG - Intergenic
945589717 2:211715199-211715221 CTGGAAAATTTGAGAAGAAAGGG + Intronic
945760338 2:213905922-213905944 TTGGTGTGTTTGAGAAACACAGG + Intronic
945811009 2:214550130-214550152 CTGGAGCATTTGAGCAATAAAGG - Intronic
945824120 2:214699321-214699343 CAGGTGTATTTTGGGAAAAAGGG + Intergenic
946316007 2:218913020-218913042 CTGGTGTCTTTTATAAAAATGGG + Intergenic
948088358 2:235269123-235269145 CAGGGGTATTGGAGAAAATAGGG - Intergenic
948553418 2:238791327-238791349 CTCTTTTATTTAAGAAAAAAAGG + Intergenic
1171385104 20:24764566-24764588 CTTGTGTCTTTCAGAAAAACAGG - Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173619356 20:44424815-44424837 GTGTTGTGTTTGAGAAAGAAGGG + Intronic
1175327181 20:58137891-58137913 CTGCTGTATCTGAGACACAAAGG - Intergenic
1175474357 20:59260121-59260143 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175474550 20:59262155-59262177 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1176893167 21:14343850-14343872 ATTGAATATTTGAGAAAAAATGG + Intergenic
1176908781 21:14537181-14537203 CTGGTGTGTTTGAGAAGCAGTGG - Intronic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178795339 21:35738843-35738865 CTGGTGTATGAAAAAAAAAAAGG + Intronic
1178952087 21:36993509-36993531 CTGGTGTCTTTGTGATAATATGG + Intergenic
1180242480 21:46519545-46519567 CTTTTATATTTGAGAAAGAAAGG + Intronic
1184156796 22:42672989-42673011 CTGGTGTATGTGTGCAGAAAGGG + Intergenic
1184824087 22:46935326-46935348 CTGGAGTACATGAGAAAAAATGG + Intronic
1185240947 22:49746516-49746538 CAGGTTTACTTGAGAAGAAAAGG - Intergenic
949197859 3:1335153-1335175 CTGGTTCATTTCAGAGAAAATGG + Intronic
949378624 3:3419084-3419106 CTGGTGAGTATGAGAAGAAAAGG + Intergenic
951258391 3:20478373-20478395 CTGGTTTTATTGAGAATAAAAGG + Intergenic
951981103 3:28568027-28568049 CTAGTGAATTTGGGAAAAGATGG + Intergenic
952624852 3:35392012-35392034 CTAGTGGAGTTGTGAAAAAAGGG - Intergenic
952776680 3:37053148-37053170 CAGTTGTATTGAAGAAAAAAAGG + Exonic
953292689 3:41682205-41682227 TTGATGTATTTGATAAAACATGG - Intronic
956520351 3:70096886-70096908 CTGGTGAGTTTGAGAAACACTGG + Intergenic
956847765 3:73198859-73198881 CCTGTGTATTTGAGGAAGAAAGG - Intergenic
957264948 3:77951101-77951123 CTTCTGCATTTGAGTAAAAAAGG + Intergenic
957634819 3:82768275-82768297 CTGGAGTAATTTAGAAAAAATGG + Intergenic
958583154 3:96052354-96052376 CTAGTGTAGTTGTGAGAAAAGGG - Intergenic
959537890 3:107507789-107507811 CTGTTGCATTTGAGAAATTAAGG + Intergenic
959968763 3:112384885-112384907 CTGGTGTTTTTGAGAGATGAGGG - Intergenic
960332139 3:116373754-116373776 TTTGTATATTTAAGAAAAAAGGG + Intronic
960395786 3:117135406-117135428 CTGGTGTATTTGATTCCAAAGGG + Intronic
960493809 3:118351209-118351231 CTGGTGGTGTTGAGACAAAATGG - Intergenic
963585887 3:147187429-147187451 CTGGTGTATTTCATTAAACATGG - Intergenic
963685813 3:148432339-148432361 GTGATGTCTTTGAGAAGAAAAGG + Intergenic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
965078286 3:164004753-164004775 CTGATTTATCTGAGAAAAGAAGG + Intergenic
965308262 3:167096062-167096084 CTGGAGAATTTCAGAAAAGAAGG + Intergenic
965364557 3:167782884-167782906 CTGGTGTATCTGATGCAAAACGG + Intronic
965869902 3:173252897-173252919 CTGGTGGAGTTGTGAAAAGAGGG - Intergenic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
969408590 4:7012676-7012698 CTGTTGTATTTAACAATAAAAGG + Intronic
970523617 4:16909991-16910013 TTGCTGTATTAGAGAAAAATTGG - Intergenic
970538654 4:17055628-17055650 CAGGTGTAGATGAGAAAAGAAGG + Intergenic
970903754 4:21191238-21191260 CTTGTGTATTTGATAGCAAAGGG + Intronic
971120815 4:23702881-23702903 ATGGTGGGTTGGAGAAAAAAGGG - Intergenic
971131294 4:23813794-23813816 TTGGGGTCTTTGAGAAAATAAGG + Exonic
971769612 4:30879272-30879294 CTTGTTTATTGGAGGAAAAAAGG - Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
974173740 4:58298465-58298487 ATTATGCATTTGAGAAAAAATGG - Intergenic
974447820 4:62009664-62009686 CTGGTAGATGTGTGAAAAAATGG - Intronic
975192954 4:71487589-71487611 CTTTTGTATTGGAGAAAAAGGGG + Intronic
976212932 4:82690189-82690211 CTGAGGTATTTGGGAATAAAGGG + Intronic
976261765 4:83152168-83152190 CTGAAGTATTTAAGAGAAAAGGG + Intergenic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977300547 4:95262152-95262174 GTGTTGTAGTTGAGAAAATAAGG + Intronic
977804067 4:101275531-101275553 CTCGTGTATTTGAAAATAATTGG - Intronic
978195510 4:105967334-105967356 CAGGTGTTTGTGAGAAAACACGG + Exonic
978545025 4:109861753-109861775 CTGGTGTCTTTAGTAAAAAAAGG + Intronic
979001017 4:115219742-115219764 CTGTTGCATTTGACAAAATAAGG + Intergenic
979136416 4:117117102-117117124 CTCGTGTATTTGAGTTAACAGGG + Intergenic
980536910 4:134136981-134137003 GTGGTCTATTTTAGAACAAATGG + Intergenic
980710103 4:136554880-136554902 TTGTGGTATTTGAGAAAGAATGG + Intergenic
981466578 4:145079385-145079407 CTGGTGAAGTTGTGAAAAAAAGG + Intronic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
982186085 4:152801368-152801390 TTGGTGTGTTTGAGAAACAGTGG + Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982919268 4:161253534-161253556 GTGGTGAATTTGAGAGGAAAGGG + Intergenic
983778093 4:171633512-171633534 CTGGTGAAGTTGAGGAGAAAAGG - Intergenic
984117973 4:175705906-175705928 CTGTTCTATTTGAGAATTAATGG - Intronic
984339851 4:178443123-178443145 CTGATGTATTGGAGGAAAATAGG + Intergenic
987288004 5:16478660-16478682 ATTGTATATTTGAGAAAAGAAGG + Intronic
987698652 5:21366145-21366167 TTAGTGTATTTTAGAAAATAAGG - Intergenic
988754001 5:34225385-34225407 TTAGTGTATTTTAGAAAATAAGG + Intergenic
988782464 5:34534965-34534987 CATGAGTATTTGAGAAAGAATGG - Intergenic
989996391 5:50837744-50837766 CTGGTGCATCAGAAAAAAAATGG + Intronic
991311389 5:65246766-65246788 CTGATGTATTCTAGAAACAATGG - Intronic
991741783 5:69686228-69686250 TTAGTGTATTTTAGAAAATAAGG + Intergenic
991755909 5:69868980-69869002 TTAGTGTATTTTAGAAAATAAGG - Intergenic
991793357 5:70265967-70265989 TTAGTGTATTTTAGAAAATAAGG + Intergenic
991821167 5:70561533-70561555 TTAGTGTATTTTAGAAAATAAGG + Intergenic
991835237 5:70744128-70744150 TTAGTGTATTTTAGAAAATAAGG - Intergenic
991885732 5:71265502-71265524 TTAGTGTATTTTAGAAAATAAGG + Intergenic
992226976 5:74628347-74628369 TTGCTGTATTTTAGAAAATAGGG - Exonic
994108277 5:95970878-95970900 CTGGTTTAGTTGAGAAATATTGG - Intergenic
994172925 5:96678137-96678159 CTGGTAATTTTGAGAAGAAAAGG - Intronic
995862537 5:116656887-116656909 CCTGTGCATTTGAGAAAGAAAGG + Intergenic
995865936 5:116690717-116690739 CTTGTTTTTTTGAGAATAAATGG - Intergenic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998336925 5:141381478-141381500 CTAGTGTAATTGAGAAAACAGGG - Intronic
999052611 5:148539728-148539750 CTGGCGAAGTTGAGGAAAAAAGG + Intronic
1000217043 5:159169579-159169601 CTGATGAATTTTAGAAGAAATGG - Intronic
1000520228 5:162285673-162285695 CTGGTATATTTGAGCTAACATGG + Intergenic
1002778835 6:351222-351244 CTGGGGAATTTGAGAACACACGG - Exonic
1003774243 6:9341441-9341463 TTGCTGTCTGTGAGAAAAAAAGG + Intergenic
1005552182 6:26932225-26932247 TTAGTGTATTTTAGAAAATAAGG + Intergenic
1007927878 6:45664264-45664286 CTGGTGTATTTGTGGAAAAGGGG + Intronic
1008233651 6:49016357-49016379 CTGGTGTTTTTATGAAAAAATGG + Intergenic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1009720723 6:67465896-67465918 GTGGGGTTATTGAGAAAAAAAGG + Intergenic
1009766874 6:68089054-68089076 CAGGTGGATTTGACAAAATAAGG - Intergenic
1009864668 6:69382092-69382114 ATGGTGAAGTTGAGAGAAAAGGG + Intronic
1010352667 6:74893426-74893448 CTGGTCTAAATGGGAAAAAAAGG + Intergenic
1010682837 6:78817267-78817289 CTGGTGAAGTTGAAAAGAAAAGG + Intergenic
1010696851 6:78985899-78985921 CTCATTTATTTGTGAAAAAAAGG - Intronic
1012153978 6:95793443-95793465 GTGGAGTATTAGAGAAAGAAAGG + Intergenic
1012236562 6:96823751-96823773 ATGGTGTAAAAGAGAAAAAATGG - Intronic
1012479086 6:99648194-99648216 CTGGTGCATTTATGAAAACATGG - Intergenic
1012767033 6:103380551-103380573 TTTGTGTGTTTAAGAAAAAATGG + Intergenic
1013294285 6:108745048-108745070 CATGTGTATTTGAGACACAAAGG + Intergenic
1013318646 6:108965462-108965484 CTATTGTAATTGAGAAAATACGG + Intronic
1014755124 6:125294050-125294072 CTGGAGTAATTCAGAAATAAAGG - Intronic
1015069524 6:129074594-129074616 TTGTTGTCTTTGAGAGAAAATGG + Intronic
1016249607 6:142024717-142024739 CTGTTTGTTTTGAGAAAAAATGG - Intergenic
1016831931 6:148442584-148442606 CTGGCCTGTTTGAGAATAAATGG + Intronic
1019280290 7:196315-196337 CTGCTGAATTGGACAAAAAAGGG + Intronic
1019362029 7:609666-609688 CAGGTGCATTTCAGAAAATATGG - Intronic
1020883698 7:13796036-13796058 CTGATTAATTTCAGAAAAAAAGG - Intergenic
1021743855 7:23717660-23717682 CTGGTATATTTGAAAAGAAGAGG + Intronic
1022543838 7:31166669-31166691 ATGGTGTATTTGAGAAACTCAGG + Intergenic
1023099443 7:36700075-36700097 CCGGTGTCTTTGTCAAAAAATGG + Intronic
1023159985 7:37287829-37287851 TTGGTGTGTTAGAGAACAAAAGG - Intronic
1025763410 7:64416629-64416651 CTGGGGTAATTGTCAAAAAATGG - Intergenic
1027499699 7:78933727-78933749 GTGGTTTATTGGAGAAAATAAGG + Intronic
1027501428 7:78956745-78956767 CTGATGTATTACATAAAAAACGG - Intronic
1027984892 7:85274927-85274949 CAGTTGTATTTTAGAAAAATGGG + Intergenic
1028739652 7:94259009-94259031 CTGGTGCCTGTGAGAAAACAAGG + Intergenic
1031026527 7:116685841-116685863 CTGAGGCATGTGAGAAAAAAAGG - Intronic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1031651230 7:124292498-124292520 CTGGGGATTTTGAGAAAAAGTGG + Intergenic
1031953688 7:127919842-127919864 ATGGTGTATTTGATATAAATTGG + Intronic
1034252706 7:149705148-149705170 CGTGTCTATTTGAGAAAAAGAGG - Intergenic
1035549441 8:509238-509260 CTAGTGTAACTGTGAAAAAAGGG - Intronic
1036158688 8:6366283-6366305 CTGGAAGATTTGAAAAAAAAAGG + Intergenic
1038156852 8:24999586-24999608 CTGGTGCATGTGAGAATGAATGG + Intergenic
1038956748 8:32476129-32476151 AAGGTGTATTTGACAAAAATTGG + Intronic
1039383022 8:37103336-37103358 GTGGTGCATTTCAGGAAAAAGGG - Intergenic
1042107852 8:65348101-65348123 CTGGTGCATGTGAGGAAAAGGGG + Intergenic
1042248670 8:66733852-66733874 CTGATTTATTTGAAAACAAAGGG + Intronic
1042749777 8:72145637-72145659 CTTATTTATTTGAGAAAAACAGG - Intergenic
1042780956 8:72490584-72490606 CTGGTGTATGCGAGAAAGAATGG - Intergenic
1043255338 8:78129529-78129551 CTGGAGAATTTGTGACAAAAAGG + Intergenic
1043655162 8:82655316-82655338 CTGGAGAATTCTAGAAAAAAAGG - Intergenic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1045039528 8:98208856-98208878 CTTGTGTGATTGATAAAAAATGG - Intronic
1046300978 8:112288696-112288718 ATGGTGTTTTTGAAAAAAAGTGG + Intronic
1046356380 8:113090839-113090861 CTGGAGAATGTGAGAAAAAGGGG - Intronic
1047902006 8:129432643-129432665 CTTTGGTAGTTGAGAAAAAATGG - Intergenic
1048163240 8:132039705-132039727 CTGTTGTGGTTGAGAAATAAGGG - Intronic
1048226482 8:132592028-132592050 CTGGTGTATTTGATGAACTAAGG + Intronic
1050765146 9:9123672-9123694 CTTGGGTATTTCAGAACAAAAGG + Intronic
1050876714 9:10648236-10648258 TTGATGTTTTTGAGAATAAAAGG + Intergenic
1051168746 9:14295925-14295947 CTGGTAAATCTGAGACAAAAAGG + Intronic
1051888549 9:21920183-21920205 CTGGTGTCTTTTAGAAAGGAGGG + Intronic
1052295183 9:26889966-26889988 TTAGTGTATTTGTGAAGAAAAGG - Intronic
1052684674 9:31740140-31740162 ATAATGTATATGAGAAAAAAGGG - Intergenic
1053032304 9:34791274-34791296 CTGGTGTATAAGAGAAAAGAGGG + Intergenic
1054964538 9:71007415-71007437 CGTGTGTTGTTGAGAAAAAATGG - Intronic
1055013677 9:71593610-71593632 CTGGAGTATTTGAGCAACCAAGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055717541 9:79134498-79134520 TTTGTGTATTTAAGAGAAAAGGG + Intergenic
1055941284 9:81652476-81652498 CTGGTGTTGTTTAGAAATAAAGG - Intronic
1056041582 9:82673456-82673478 ATGGTGTAATAGATAAAAAATGG - Intergenic
1057994083 9:99804024-99804046 CTTGTGTAATTGAGATAAAAGGG - Intergenic
1058414472 9:104771862-104771884 CTGGTGAGGTTGTGAAAAAAAGG - Intronic
1059550040 9:115220085-115220107 TGTGTGTATTTAAGAAAAAAGGG + Intronic
1059637914 9:116188451-116188473 CTGGGCTCTTTGAGAAAACAGGG - Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1187480010 X:19646846-19646868 CTTCTGTATTGGATAAAAAATGG + Intronic
1188196957 X:27247137-27247159 TTGATGTATTAGTGAAAAAAGGG - Intergenic
1188299196 X:28486734-28486756 CTGGTATATTTGTGGAATAATGG + Intergenic
1188837355 X:34974879-34974901 CTGATGCATTAGAGAAGAAAGGG + Intergenic
1189381834 X:40507626-40507648 CTGGTTTATTTGGGAGGAAACGG + Intergenic
1191710561 X:64146085-64146107 CTGCTGTATTTGAAATAAATTGG + Intergenic
1192926983 X:75765361-75765383 CTGGCGAAGTTGTGAAAAAAAGG + Intergenic
1193240002 X:79157122-79157144 CTGGAGTATTTGATAAAATGTGG + Intergenic
1196961512 X:121008027-121008049 CTTGTTTACTTGAGAAAGAATGG + Intergenic
1200212531 X:154353147-154353169 CTGGTGCATGTGAAGAAAAATGG - Exonic
1201598019 Y:15693986-15694008 CTGGTGTTTTTATTAAAAAAAGG + Intergenic