ID: 1088606794

View in Genome Browser
Species Human (GRCh38)
Location 11:111540736-111540758
Sequence GCCTAGAGATGCTGCTGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088606786_1088606794 3 Left 1088606786 11:111540710-111540732 CCCGCCTCCCGTGCGGTCCGTCG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606779_1088606794 11 Left 1088606779 11:111540702-111540724 CCCTCCCCCCCGCCTCCCGTGCG 0: 1
1: 0
2: 2
3: 33
4: 481
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606777_1088606794 26 Left 1088606777 11:111540687-111540709 CCGACTGACTCCGCGCCCTCCCC 0: 1
1: 0
2: 1
3: 25
4: 237
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606780_1088606794 10 Left 1088606780 11:111540703-111540725 CCTCCCCCCCGCCTCCCGTGCGG 0: 1
1: 1
2: 4
3: 103
4: 699
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606789_1088606794 -1 Left 1088606789 11:111540714-111540736 CCTCCCGTGCGGTCCGTCGGTGG 0: 1
1: 0
2: 5
3: 1
4: 21
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606787_1088606794 2 Left 1088606787 11:111540711-111540733 CCGCCTCCCGTGCGGTCCGTCGG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606783_1088606794 6 Left 1088606783 11:111540707-111540729 CCCCCCGCCTCCCGTGCGGTCCG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606791_1088606794 -4 Left 1088606791 11:111540717-111540739 CCCGTGCGGTCCGTCGGTGGCCT 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606784_1088606794 5 Left 1088606784 11:111540708-111540730 CCCCCGCCTCCCGTGCGGTCCGT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606792_1088606794 -5 Left 1088606792 11:111540718-111540740 CCGTGCGGTCCGTCGGTGGCCTA 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606785_1088606794 4 Left 1088606785 11:111540709-111540731 CCCCGCCTCCCGTGCGGTCCGTC 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606782_1088606794 7 Left 1088606782 11:111540706-111540728 CCCCCCCGCCTCCCGTGCGGTCC 0: 1
1: 0
2: 2
3: 23
4: 279
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1088606778_1088606794 16 Left 1088606778 11:111540697-111540719 CCGCGCCCTCCCCCCCGCCTCCC 0: 1
1: 1
2: 62
3: 806
4: 6231
Right 1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088606794 Original CRISPR GCCTAGAGATGCTGCTGCCG CGG Exonic
900537701 1:3187064-3187086 GCCTGGTGATCCTGCTGCAGGGG + Intronic
901413258 1:9099772-9099794 GCCTGCAGATGCAGCTGCGGCGG + Intergenic
901507115 1:9691784-9691806 GGAGAGAGATGCTGCTGCCTGGG + Intronic
901561506 1:10075371-10075393 GGCAAGAGATGCTGGTGCCTTGG - Intronic
903492823 1:23743004-23743026 GCCTAGGGTGGCTGCTACCGCGG + Intergenic
905031981 1:34890729-34890751 GCCTTGAGATGCTGCAGCCTTGG + Intronic
906456479 1:46001618-46001640 GCCTATATGTGCTGCTGCCAGGG + Intronic
909585191 1:77281751-77281773 GCCCAGGGATGCAGCTACCGGGG - Intergenic
916747868 1:167698178-167698200 GCCTGGGCATGCTGCTGCAGGGG + Intronic
919732168 1:200920317-200920339 GCCTAGAGAAGCTGGTTCTGGGG + Intergenic
919795630 1:201319883-201319905 GCCTTGGGATGCAGCTGCGGAGG + Intronic
924625576 1:245694521-245694543 GTCTGCAGATGCTGCTGCTGAGG - Intronic
1064440095 10:15345835-15345857 GCCTAGAGAGGCCCCTGCCGTGG + Intronic
1066340420 10:34527204-34527226 GTCTAGAGATGATGCAGCAGGGG + Intronic
1067431763 10:46250019-46250041 GCCTGAAGATCCTGCTGCCCGGG + Intergenic
1067441657 10:46312155-46312177 GCCTGAAGATTCTGCTGCCCGGG - Intronic
1070843418 10:79503641-79503663 GCCTGGAGTTGGTGCTACCGGGG + Intergenic
1071802590 10:89080335-89080357 GGCCAGAGATGCTGCTTCTGTGG - Intergenic
1072057003 10:91768549-91768571 GCCTAGTGATGCTGTAGCAGTGG - Intergenic
1076560509 10:131360304-131360326 GTCTAGAGATGCTTGTGCTGGGG + Intergenic
1083749597 11:64753921-64753943 TCTTGGAGACGCTGCTGCCGCGG - Exonic
1083968465 11:66057636-66057658 GACTAGAAAGGCTGCTGCCCAGG - Intronic
1084747445 11:71182121-71182143 GCCTAAAGAAGATGCTGCCTTGG - Intronic
1085022956 11:73220499-73220521 GCCTTCAGATGCTCCTGCTGAGG + Intronic
1086110564 11:83194052-83194074 CCCTAGAGACGCTGCGGCAGTGG - Intronic
1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG + Exonic
1089276879 11:117342998-117343020 GCCTATAGATGCAGCTACCCAGG - Intronic
1089299455 11:117489860-117489882 GAATAGAGATGCTTCTGCCCTGG - Intronic
1089901608 11:121992471-121992493 TCCCAGAGATGCTGCAGCTGAGG - Intergenic
1090855396 11:130606234-130606256 ACCTAGAGATGCTGCTGCACAGG - Intergenic
1097794118 12:63844266-63844288 GGCTGGGGATGCTGCTGCCACGG - Intergenic
1099406028 12:82263553-82263575 GCCTAGAGATGCTGTTGCAAAGG + Intronic
1100874452 12:98947328-98947350 GGCTGGAGATGCTGCAGCAGTGG + Intronic
1101436325 12:104667866-104667888 CCCTAGAGATTCTGATTCCGTGG - Intronic
1104900862 12:132188945-132188967 GCCAGGAGATGCTGGTTCCGGGG + Intergenic
1106371762 13:29141429-29141451 GCCTAGAGATGCTGTTGGAGAGG + Intronic
1112699579 13:101990658-101990680 GCATAGAGAGCCTGCTGCCCAGG - Intronic
1113670235 13:112171128-112171150 GCCTAGAGCTCCTTCTGCAGCGG + Intergenic
1117535648 14:56700381-56700403 GCCTAGAGATTCTGCTTGAGTGG + Intronic
1122977038 14:105174976-105174998 GACTGGAGATGCTGCTGACTAGG - Intronic
1127378802 15:58409940-58409962 CCCTAGAGATTCTGCTTCAGTGG - Intronic
1127903963 15:63362407-63362429 GCATTGAGAAGCTGCTGTCGTGG - Intronic
1131766223 15:95678332-95678354 GCCAAGAGGAGCTGCTGCCAAGG - Intergenic
1132371847 15:101305117-101305139 GCTCAGAGATGCTGCTCCTGGGG + Exonic
1132727214 16:1344128-1344150 GCCTGGAGCTGCTGCTGAAGTGG + Exonic
1137531482 16:49281433-49281455 TCCTGGAGCTGCTGCTGCTGGGG - Exonic
1140455775 16:75104823-75104845 GCCTGGAGGAGCTGCTGCAGGGG + Exonic
1141671947 16:85496756-85496778 GCAGAGAGATGCTGTTGCCAGGG + Intergenic
1141999250 16:87654798-87654820 ACGTGGAGATGCTGCTCCCGTGG + Intronic
1142302290 16:89265716-89265738 GCCTGGAGACCCTGCTGCCCGGG - Intergenic
1142425410 16:89999872-89999894 GTGTAGAGCTGCTGCTCCCGGGG - Intergenic
1143359012 17:6352262-6352284 GCCTGGAGAACCTGCTGCCAGGG + Intergenic
1143615263 17:8045797-8045819 GCCAGGAGATGCTGCTGAAGCGG - Intronic
1147293524 17:39462241-39462263 GCCCAGGGATGCTGCTTCGGGGG - Exonic
1149936429 17:60811354-60811376 GCCTGGAGTTGCTGCTGTCTGGG - Intronic
1152070466 17:78131581-78131603 CCGCCGAGATGCTGCTGCCGCGG + Exonic
1153334772 18:3911937-3911959 CCCAAGTGATGCTGCTGCTGTGG - Intronic
1153659990 18:7317771-7317793 GCCTAGGGATGCTGCTGCTGGGG - Intergenic
1162385522 19:10358477-10358499 GTCTAGCTATGCTGCTGCCCAGG + Intronic
1162394435 19:10408568-10408590 GCCTAGAAATGCAGGTTCCGGGG - Intronic
1166700124 19:44877537-44877559 GCCTAGAGATGAGGCAGCCACGG + Intronic
1168108669 19:54180016-54180038 GCCTAGCAATGCAGGTGCCGGGG + Intronic
926042921 2:9689544-9689566 GGCCAGAGATGCTGCTGATGAGG + Intergenic
927646240 2:24878770-24878792 GCCTGTAGAGGCTGCTGCAGTGG + Intronic
933682451 2:85114159-85114181 GCCTAGAGATCCTGGTTCCCGGG + Intergenic
937603037 2:123762218-123762240 ACCTACAGATGCTCCTGCAGTGG + Intergenic
937622232 2:124001989-124002011 GCCTACAGATGCTTCTGCTGTGG - Intergenic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
940383714 2:153046154-153046176 TCCTGGAGATGCTTCTGCCCAGG + Intergenic
941107154 2:161367483-161367505 ACCTACAGATGCTCCTGCAGTGG + Exonic
942184883 2:173415604-173415626 GCATAGAGATGGAGCTGCCTCGG + Intergenic
945008480 2:205436051-205436073 GCCCATAGATGGTGCTGCCTAGG + Intronic
946536705 2:220637976-220637998 GGCTAGAGATGGTGCTGACTTGG + Intergenic
1172627701 20:36357615-36357637 TCCTAAAGATGCTCCTGCCTGGG - Intronic
1172821562 20:37739623-37739645 GAAAAGAGATGCTGCTGCTGGGG - Intronic
1173628817 20:44494237-44494259 GCAGTGAGATGCTGCTGCTGTGG + Exonic
1173836458 20:46129096-46129118 GCCTGGTGCTGCTGCTGCTGTGG + Exonic
1174129060 20:48328901-48328923 GCCCAGATCTGCTGCTGCCTGGG + Intergenic
1176214491 20:63941746-63941768 TCCTAGACCTGCTGCTGCCCCGG - Intronic
1177387285 21:20425035-20425057 GCATAGAGTTGCTGCTGTCCAGG + Intergenic
1180025734 21:45161124-45161146 GTCTGGAGTTGCTGCTGCCGTGG + Intronic
1181431092 22:22882370-22882392 GCCTGGAGATGCTGCTGGGAAGG - Intronic
1181893089 22:26081961-26081983 GCCTAGAGATGCTGCAGTTCTGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
953395036 3:42562337-42562359 GCCCAGGGATGCTGCAGCTGTGG + Intronic
953593191 3:44280790-44280812 GCCTGCAGCTGCTGCTGCCAGGG - Intronic
955563076 3:60213975-60213997 GCCTACAGATCCTGCAACCGTGG + Intronic
957351042 3:79021959-79021981 GCCTAGAGATGATATTTCCGAGG + Intronic
959055438 3:101562953-101562975 AGCTAGAGATGCTGCTGACCTGG + Intronic
963135582 3:141900604-141900626 CCATAGAAATGCTGCTGCAGAGG - Intronic
968517744 4:1021963-1021985 GCCATGAGAGGCTGCTGACGTGG + Intronic
968576372 4:1368071-1368093 TCCTGGAGGTGCTGCAGCCGGGG + Intronic
968975053 4:3817693-3817715 GCCTAGAGAGGCTGCGGCTGGGG + Intergenic
969944071 4:10764799-10764821 TCATAAAGATGCTGCTGACGAGG - Intergenic
969971932 4:11056720-11056742 GCCCACAGATGAAGCTGCCGAGG - Intergenic
971195699 4:24470758-24470780 GCCTCCCGCTGCTGCTGCCGCGG + Intergenic
972689954 4:41387591-41387613 GCACAGAGAAGCTGCTGCCTTGG - Intronic
973197571 4:47463370-47463392 GCCTAGAGGTGCAGCTCCAGGGG - Intronic
975342551 4:73258448-73258470 GCCTTGTGGTGCTGCTGCTGCGG + Exonic
975386275 4:73763847-73763869 CCCTGTAGATGCTGCTGCTGTGG + Intergenic
980625573 4:135371262-135371284 GCATAGAGTTGCTGCTGTCCAGG + Intergenic
982099744 4:151956148-151956170 GCTTTCAGATGCTGCAGCCGTGG + Intergenic
986355718 5:6923806-6923828 GCCTGGAGATGATGCTGCCTTGG + Intergenic
986975915 5:13393713-13393735 GAACAGAGATGCTGCTGCTGAGG - Intergenic
988255016 5:28809571-28809593 GGCCAGAGATGCGGCTGCGGTGG - Intergenic
997235324 5:132269180-132269202 GCCTAGAGAGGCAGCTGCATGGG + Intronic
997286220 5:132680624-132680646 GGCTAGAGATGATGGTGGCGTGG + Intronic
997286242 5:132680764-132680786 GGCTAGAGATGATGGTGGCGTGG + Intronic
999467895 5:151824228-151824250 GCCTCGAGATCCTCCTGCCTCGG + Intronic
1002586018 5:180248653-180248675 GGCCAGAGCTGCTGCTGCTGTGG + Intronic
1002887978 6:1312633-1312655 GCCTAGAGAAGCTGGTGCCAGGG - Exonic
1003042580 6:2701721-2701743 CCCAGGAGATGCTGCTGCTGCGG - Intronic
1003154381 6:3578763-3578785 GGGTGGACATGCTGCTGCCGGGG + Intergenic
1003306219 6:4931981-4932003 GCCTAGAAATGTTGCTTCGGTGG + Intronic
1004126911 6:12883018-12883040 TTCTAGTGATGCTGCTGCCCTGG + Intronic
1004875032 6:19942763-19942785 GCAAAGAGATGCAGCTGCTGGGG - Intergenic
1017911304 6:158795338-158795360 GCCTTGAGATCCTCCTGCCTTGG - Intronic
1021847832 7:24779806-24779828 GCCTAGGGATGCTGTTGGTGTGG - Intergenic
1022046825 7:26628231-26628253 GACTAGAGAGGCTGCTGGCAGGG + Intergenic
1022366896 7:29730314-29730336 GTCCAGAGATGCTGCTGTCCAGG + Intergenic
1025226929 7:57173698-57173720 GCCTATAAATGCTGTTGCTGTGG - Intergenic
1025229993 7:57197007-57197029 GCCTATAAATGCTGTTGCTGTGG - Intergenic
1029825367 7:103187145-103187167 GTCCAGAGATGCTGCTGTCCAGG - Intergenic
1032119246 7:129144773-129144795 GCCTGGAGCTGCTGGAGCCGCGG - Intergenic
1032544085 7:132727554-132727576 GCCAAGAGAGCCCGCTGCCGAGG + Exonic
1032854591 7:135823914-135823936 CCCTACTGATGCTGCTGCTGTGG + Intergenic
1033852361 7:145513032-145513054 GCCCAGAGATGCTCCTGCAGTGG - Intergenic
1034416131 7:150965174-150965196 GTCTGGAGATGCTGCTTCTGTGG - Intronic
1036460983 8:8952372-8952394 GCTTAGACACGCTGCTGCCTGGG + Intergenic
1037615655 8:20516943-20516965 GCCTAGAGAGTCTACTGCAGAGG + Intergenic
1038293096 8:26267345-26267367 GCCGAGAGACGCTGCTTCAGGGG - Intergenic
1039758151 8:40545077-40545099 GCCTAGAGATGCCCCTGGCCTGG + Intronic
1043116033 8:76255038-76255060 GCCTACAGACACTGCTGCTGTGG + Intergenic
1044545349 8:93453260-93453282 GTATAGAGATGTTGCTGCCTTGG - Intergenic
1046863965 8:119125439-119125461 GCCTAGAAATGGTGGTGCAGAGG - Intergenic
1047422883 8:124721826-124721848 GCTTGGAGATGCTGCTGCCTGGG - Intronic
1047689553 8:127337643-127337665 GCCTACACATGCTGCTTCCCTGG + Intergenic
1048667631 8:136680759-136680781 TCCTAGAGATGCATCTGCCCAGG - Intergenic
1049354388 8:142180308-142180330 GCCAAGTGATGCTCCTGCTGGGG + Intergenic
1051672204 9:19522229-19522251 GCCTCGAGATCCTCCTGCCTTGG + Intronic
1052946578 9:34173287-34173309 CCCAAGTGATCCTGCTGCCGTGG - Intergenic
1055427972 9:76215513-76215535 CCCTAGAGATGCTGCTAAAGAGG + Intronic
1062445898 9:136594467-136594489 GCCCAGGGACGCTGCTGCTGAGG - Intergenic
1187388941 X:18873333-18873355 GCCTAGATTTACTGCTGCCTCGG + Intergenic
1188287013 X:28339416-28339438 ACCTGGTGATGCTGCTGCCATGG + Intergenic
1189593361 X:42538880-42538902 GTCTAGAGAAGCTCCTGCCTTGG + Intergenic
1189960870 X:46323719-46323741 GCCTAGAGATGCAGAGGCCATGG - Intergenic
1193817997 X:86126338-86126360 GCCTAGAGCTGCTGCTAGCCGGG + Intergenic
1196375233 X:115026014-115026036 GCCTAGAGATGATGGTGACTTGG + Intergenic