ID: 1088607053

View in Genome Browser
Species Human (GRCh38)
Location 11:111541881-111541903
Sequence TCTCATTTGCAGGAAGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088607053_1088607058 3 Left 1088607053 11:111541881-111541903 CCTTCGCCTTCCTGCAAATGAGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1088607058 11:111541907-111541929 GAAGGACACTTCCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 255
1088607053_1088607060 16 Left 1088607053 11:111541881-111541903 CCTTCGCCTTCCTGCAAATGAGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1088607060 11:111541920-111541942 TGAAGGCAGGAGAACCAGATAGG 0: 1
1: 0
2: 7
3: 33
4: 377
1088607053_1088607061 23 Left 1088607053 11:111541881-111541903 CCTTCGCCTTCCTGCAAATGAGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1088607061 11:111541927-111541949 AGGAGAACCAGATAGGCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 136
1088607053_1088607057 -1 Left 1088607053 11:111541881-111541903 CCTTCGCCTTCCTGCAAATGAGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1088607057 11:111541903-111541925 AAGAGAAGGACACTTCCTGAAGG 0: 1
1: 0
2: 2
3: 24
4: 281
1088607053_1088607062 24 Left 1088607053 11:111541881-111541903 CCTTCGCCTTCCTGCAAATGAGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1088607062 11:111541928-111541950 GGAGAACCAGATAGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088607053 Original CRISPR TCTCATTTGCAGGAAGGCGA AGG (reversed) Intronic
901028480 1:6292006-6292028 GGTCCTTTGCAGGGAGGCGAGGG - Intronic
907278337 1:53328900-53328922 TGTCTTCTGCAGGAAGGAGAAGG + Intergenic
907282393 1:53359707-53359729 GCTCAGCTGCAGGAAGGCCATGG - Intergenic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
907934596 1:59031059-59031081 ACTCATTTGGAGGAAGCCCAGGG + Intergenic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
911347444 1:96714115-96714137 TATCATTTTGAGGAAGGGGAAGG - Intergenic
912063323 1:105702062-105702084 TCTCATTTGCAACAAGTCAATGG - Intergenic
913062821 1:115223489-115223511 TCTGCTTTGTAGGAAGGTGACGG - Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
914460382 1:147878234-147878256 TATCATGTTCAGGAAGGCCAGGG + Intergenic
915029188 1:152861545-152861567 TCTCATGCTCAGGAAGGAGATGG + Intergenic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916770785 1:167905447-167905469 ACTCATTTGCAGGAAGGGGTAGG + Intronic
920691468 1:208150123-208150145 TCTCTTTTCCATGAAGGGGAAGG + Intronic
921420172 1:214938074-214938096 TTTCATTTGCAGGAAATCAAAGG + Intergenic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
924085184 1:240443891-240443913 TCTTATTTTCAGGAAGGCATTGG + Intronic
1063454274 10:6172266-6172288 GCTCCTTTGCAGGAAGGAGAGGG + Intronic
1065410083 10:25416488-25416510 TCTCATTTTGAGGATGGGGATGG - Intronic
1065471441 10:26086023-26086045 ACTCATTTGCAGGTAGGGGGAGG + Intronic
1071174155 10:82904412-82904434 TCTCATTTTAAGGAGGGCAAAGG - Intronic
1074289528 10:112127990-112128012 TCTGTTTTGCAGGGAGGCAAAGG - Intergenic
1075021219 10:118953863-118953885 TCTCACTTGCTGGGAGGAGATGG - Intergenic
1075424515 10:122331095-122331117 TCTCATTTACAGAAAGGAAAAGG - Intronic
1080374360 11:31690335-31690357 TCTCACTTGAAGGAAAGTGAGGG - Intronic
1080765070 11:35288393-35288415 CCTCATTTGCATGCAGGGGATGG + Intronic
1080927066 11:36768565-36768587 TCTCATTGGGAGTAAGGTGATGG - Intergenic
1081665594 11:44915373-44915395 TCTCATTTCCAGGAGGGTGGGGG - Intronic
1083377607 11:62238520-62238542 TCTCATTTGCAGCAATTCCAAGG - Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1089959702 11:122604949-122604971 TCTAACCTGCAGGAAGGAGAAGG - Intergenic
1092041611 12:5389981-5390003 TCACATTTGCTGGCAGGCAATGG + Intergenic
1092068533 12:5613353-5613375 TCTGATTCCCAGGAAAGCGAGGG + Intronic
1092170988 12:6374067-6374089 TCCCACTTGCAGGAGGGAGAAGG + Intronic
1096228155 12:49882406-49882428 TCTCAGTTTCAGGTAGACGAAGG - Intronic
1097434850 12:59544073-59544095 TCTAATATGCAGGAAGGGGGTGG + Intergenic
1099417228 12:82405744-82405766 TTTCATTTGCAGGAAAGAAATGG - Intronic
1099940525 12:89182748-89182770 CCTCATTTGCAGGGAGGAAATGG - Intergenic
1102855605 12:116290482-116290504 TCTCCTTGGCAGGAGGACGAGGG + Intergenic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1104609638 12:130217642-130217664 TCTCATCTCCAGGAAGGTGTCGG + Intergenic
1108305681 13:49129936-49129958 CCTGATTTTCAGGAAGGCAAAGG - Intronic
1108847781 13:54697067-54697089 TAACCTTTCCAGGAAGGCGATGG + Intergenic
1109354459 13:61220616-61220638 TCTAATATCCAGGAAGGCAAAGG + Intergenic
1111465223 13:88599496-88599518 TCACATATGTAGGAAGGTGAGGG - Intergenic
1113963031 13:114135879-114135901 GCTCATTTGCCGGGAGGTGAGGG - Intergenic
1115888425 14:38000120-38000142 ACTCTTTTGCAGGAAAGCCAAGG - Intronic
1116490846 14:45501179-45501201 TCTCATTTGAATGAAGGTGATGG - Intergenic
1119053929 14:71399283-71399305 TCTCATTTACAGGAAACGGATGG - Intronic
1121116786 14:91349253-91349275 TCTAATTTGCAGCAAGGCCCAGG + Intronic
1121924811 14:97917887-97917909 TCTTATTGGCAGGAAAGAGATGG - Intergenic
1122434787 14:101688049-101688071 TCTCACTTGGAGGAGGGCCAAGG - Intergenic
1122506907 14:102237442-102237464 TCGCTTTTGGAGGAGGGCGAGGG - Intronic
1127805512 15:62516309-62516331 TGTCATTTGCAAAAAGGAGAAGG - Intronic
1130166499 15:81466276-81466298 GCCCATTTGCAAGAAGGCTAAGG - Intergenic
1130358097 15:83153794-83153816 TCTCTTTAGCAGTAAGGCTATGG - Intronic
1134242905 16:12518791-12518813 TCTCATCTGCAAGACAGCGATGG - Intronic
1134391674 16:13825626-13825648 TCTCATTTGCAGGGCTGCTAGGG - Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138284136 16:55794916-55794938 TCTCACCTGCAGGCAGGAGACGG + Intergenic
1138284866 16:55802071-55802093 TCTCACCTGCAGGCAGGAGACGG - Intergenic
1139223202 16:65205955-65205977 TCTCACTTGCTGGATGGGGAGGG + Intergenic
1139824227 16:69744623-69744645 ACTCATTTGGAGTAAGGCGGAGG - Intronic
1140228197 16:73095811-73095833 TTTCATTTGAAAGAAGGCGGTGG + Intergenic
1140509815 16:75498910-75498932 TGTCCTTTGCAGGAAGGGGGAGG + Intergenic
1140515611 16:75539118-75539140 TGTCCTTTGCAGGAAGGGGGAGG + Exonic
1140732146 16:77866005-77866027 TCACCTTTGAAGGAAGGTGAGGG - Intronic
1141684108 16:85560631-85560653 CCCCATTTGCAGGAAGGTGGAGG - Intergenic
1144864770 17:18328368-18328390 TCTCTGTTGCAGCAAGGCGGAGG + Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1149437316 17:56644319-56644341 TCTCATTTTCAGGTAGGGGAAGG - Intergenic
1151964701 17:77425338-77425360 TCTCAGCTGCAGGCAGGAGAGGG - Intronic
1152130333 17:78472455-78472477 TCTCATTTGCAGGAAGCTGGCGG + Intronic
1155167234 18:23241046-23241068 TTGCTTTTGCAGGAAGGGGATGG - Intronic
1158237500 18:55334585-55334607 TCTCATTTCTAGAAAGGTGAAGG - Intronic
1158672562 18:59489843-59489865 TCTCATTTGAACTAAGGCAAAGG - Intronic
1158718579 18:59901934-59901956 TCTCATTTCCATAAAGGCAATGG + Intronic
1159015336 18:63097875-63097897 TCTCCTTTCCAGGAAAGCCAAGG + Intergenic
1159993242 18:74935640-74935662 TCTGAATTGCATGAAGGCAAGGG + Intronic
1165352299 19:35282427-35282449 TCTCATTTCCAAGAAGGTGGTGG - Intronic
925077397 2:1028764-1028786 TCACATTTGCATGAAAGCCAGGG + Intronic
925329854 2:3050146-3050168 TCTCATCTGCTGGAAGGTGGAGG - Intergenic
926328747 2:11807766-11807788 TGTGATTTGCAGGATGGCCAGGG + Intronic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
935501660 2:103848472-103848494 TCTCATTAGCAGGTGGGCAAAGG + Intergenic
940404636 2:153287156-153287178 TCTCACTCGCAGGCACGCGATGG + Intergenic
942318243 2:174713651-174713673 TCTCATTGCCAGGAGGGCCATGG + Intergenic
945194106 2:207222200-207222222 TCCCAGCTGCAGGAAGGCGTGGG - Intergenic
946782292 2:223204491-223204513 TTTCATTTGCTGGAAGCTGATGG - Intergenic
947394235 2:229671708-229671730 TTTCACTTGCAGGAAAGGGACGG + Intronic
948663448 2:239520512-239520534 TCAAATCTGCAGGAAGGGGAAGG - Intergenic
1168942135 20:1721658-1721680 TCTCATTGGAAGGAAAGAGAGGG + Intergenic
1169569813 20:6893454-6893476 TGTCAATTTCAGGAAGGAGATGG - Intergenic
1179895837 21:44362725-44362747 TCTTAATTGAAGGAAGGCTAGGG - Intronic
1180645717 22:17337214-17337236 TCCCATTAGCAGGAAGGAGAAGG - Intergenic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
950916751 3:16653829-16653851 GATCAGCTGCAGGAAGGCGAGGG - Intronic
951066763 3:18276027-18276049 TCTCATATGCTGGAAGGGGCAGG - Intronic
955031785 3:55229047-55229069 TCTTCTTTGCAGTAAGGCGTTGG + Intergenic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
960686163 3:120296257-120296279 TGTCTTTTGCAGGAACGTGATGG + Intergenic
961182074 3:124885867-124885889 TCTCATTTACATGAAGGCAGTGG - Intronic
961488031 3:127231104-127231126 TTTCATTTGCAGGAAATCCAGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963349289 3:144133039-144133061 TCTCATTGGAAGGGAGGCTAGGG - Intergenic
964889390 3:161518363-161518385 TCTAATTTTCAGGAAGGGAAAGG - Intergenic
969166651 4:5321902-5321924 TCTCCTTCCCAGGAAGTCGAAGG - Intronic
970315552 4:14825547-14825569 CCTCATTCCCAGGAAGGCAATGG - Intergenic
970876999 4:20883206-20883228 TCTCATTTTCAGGAAGGCAAAGG - Intronic
971276456 4:25202463-25202485 TCTCACTTTCAGGAAGGTGGAGG - Intronic
977536085 4:98258646-98258668 TTTAATTGGCAGGAAGGCTAAGG + Intergenic
978325574 4:107550134-107550156 TCACATTTGAAGGAAGGGCAAGG + Intergenic
978556865 4:109990440-109990462 TTTCATTTGCAGAAATGTGAAGG + Intronic
982166508 4:152618199-152618221 TCTCAGTTGCCGGAAGGCAGAGG + Intergenic
982465764 4:155729282-155729304 TCTCATTTGATGGAAAGCTAGGG + Intronic
985651623 5:1110311-1110333 TCTCAATTTCATGAAGGCCAGGG + Intronic
990916806 5:60915357-60915379 TCTCTTTTGCAGGTAGGAGAGGG + Intronic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993501690 5:88673586-88673608 TCTCGTCTGAAGGAAGGCAATGG + Intergenic
995123184 5:108556767-108556789 TCTCATCTGAGGGAAGGGGAGGG + Intergenic
995239039 5:109865024-109865046 GCTCATTTGCAGGTGGGCAATGG + Exonic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
997289387 5:132716034-132716056 TCTCATTTTCGAGAAGGCCAAGG - Intronic
997933856 5:138093911-138093933 AATCCTTGGCAGGAAGGCGATGG - Intergenic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
1006503272 6:34471623-34471645 TCTCATTTGGCGGAGGGCGTGGG + Intronic
1007774617 6:44218024-44218046 TCCCATTTGCAGGGAGGGCAGGG - Intergenic
1010778161 6:79910288-79910310 TTTCATTTGCAGGAATGTGTAGG - Intergenic
1011690456 6:89862397-89862419 TCTCATTATCAGGTTGGCGAGGG + Exonic
1013751679 6:113414546-113414568 TCTCATTTGGAGGAGAGTGAGGG - Intergenic
1013758051 6:113483963-113483985 TCTCATTTGGAGGAGAGTGAGGG + Intergenic
1016446964 6:144143639-144143661 TCCTATTTGCAGGAAAGCTATGG + Intergenic
1017501632 6:155030810-155030832 TCTCATTGTCTGGAAGGCTATGG - Intronic
1017706637 6:157129678-157129700 TCACATTTGCAAAAAGGAGATGG - Intronic
1018710459 6:166494961-166494983 TCTCATTTGCAGCTAAGAGATGG - Intronic
1022010221 7:26302355-26302377 ACTCCTTTGCAGGCAGGAGATGG + Intronic
1026200066 7:68206887-68206909 TCTCATTTGCTGGACTGTGAGGG + Intergenic
1031620524 7:123929313-123929335 GGTCATTTGCAGGAAGGCCTGGG + Intronic
1031642268 7:124179943-124179965 TGTCATTTTAAGGAAGCCGAGGG + Intergenic
1033653411 7:143358778-143358800 ACACATTTGCAGGATGGCCAGGG - Intronic
1034490317 7:151389762-151389784 TCTCATTTCGAGGAAGGGGAAGG + Intronic
1038610390 8:29055380-29055402 TCACGTTTGTAGGAAGGGGAAGG - Intronic
1040788289 8:51193506-51193528 ACTCATTGGCAGGAAGGGAAGGG - Intergenic
1041100228 8:54389564-54389586 TCTCATTTGGAAGAAGACTAAGG + Intergenic
1042215065 8:66423026-66423048 GCTCATATGCAGAAAGGCAATGG - Intergenic
1044725020 8:95187874-95187896 TCTAATTTGCAGGAAACCTATGG + Intergenic
1046476656 8:114753562-114753584 TCTCATAAAAAGGAAGGCGAGGG + Intergenic
1047095045 8:121615828-121615850 TCAAATTTGCAGGAAGGCCATGG - Intronic
1048979628 8:139696419-139696441 CACCATTTGCAGGAAGGAGATGG + Intronic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1052841710 9:33297119-33297141 GCTGATTTGCAGTAAGGAGAGGG - Intronic
1053204067 9:36171688-36171710 TCTCATGGCCAGGAAGGAGAAGG + Intergenic
1056579848 9:87882873-87882895 GCTCAGTTGCTTGAAGGCGATGG + Exonic
1062407268 9:136403021-136403043 TCTGAGTGGGAGGAAGGCGAGGG + Intronic
1188234071 X:27705107-27705129 TCTCCTTTGCAGGAACGTGGAGG - Intronic
1189675442 X:43456292-43456314 CCTCATTGGCAGGAGGGCCAGGG - Intergenic
1190438356 X:50450208-50450230 TCTCATTTGCTGGAAGTCCAAGG + Intronic
1201241554 Y:11961819-11961841 TATCATTTGCTGGATGGCAAAGG - Intergenic
1201264246 Y:12190779-12190801 TCTTATGTGCAGGAAGGGGCAGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic