ID: 1088616391

View in Genome Browser
Species Human (GRCh38)
Location 11:111633765-111633787
Sequence TCCAGGACTTTTATGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1895
Summary {0: 1, 1: 0, 2: 15, 3: 110, 4: 1769}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088616389_1088616391 -7 Left 1088616389 11:111633749-111633771 CCTGGGTAACTTGTTCTCCAGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG 0: 1
1: 0
2: 15
3: 110
4: 1769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088616391 Original CRISPR TCCAGGACTTTTATGGCATT TGG Intronic
901219036 1:7572451-7572473 TCCAGGGTTTTTATGGTTTTAGG + Intronic
901223675 1:7599051-7599073 TCTAGGGCTTTTATGGTTTTTGG + Intronic
901900418 1:12356932-12356954 TCCAGGATTTGTATCACATTTGG + Intronic
901942252 1:12671861-12671883 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
901981593 1:13039222-13039244 TCTAGGGTTTTTATGGCTTTAGG + Intronic
902000489 1:13189691-13189713 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
902019733 1:13335458-13335480 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
902972620 1:20065077-20065099 TTCAGGACATTTATGACAATAGG + Intronic
903415328 1:23178304-23178326 TCCAGGTGTTTTTTGTCATTGGG + Intergenic
905712026 1:40113329-40113351 TCCAGGATTTTTATAGTTTTAGG - Intergenic
906808036 1:48798622-48798644 TCCAGAATTTTTATGGTTTTAGG + Intronic
907549845 1:55295765-55295787 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
907686078 1:56613038-56613060 TCCAGGATTTTTATAGTTTTAGG - Intronic
907986627 1:59537876-59537898 TCTAGGATTTTTATGGTTTTAGG - Intronic
908071510 1:60465658-60465680 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
908283372 1:62566575-62566597 TCTAGGATTTTTATGGTGTTAGG - Intronic
908513193 1:64866253-64866275 TTCATGACTTATATGGCCTTAGG - Intronic
908583501 1:65543580-65543602 TCTAGGGCTTTTATGGGTTTAGG + Intronic
908624178 1:66021428-66021450 TCTAGGATTTTTATGGCTTTAGG + Intronic
908630850 1:66105051-66105073 TCTAGGATTTTTATGGTTTTAGG + Intronic
908637628 1:66185947-66185969 TCTAGGATTTTTATGGTTTTAGG + Intronic
908942081 1:69447322-69447344 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
908945213 1:69487406-69487428 TCTAGGATTTTTATGGTTTTAGG + Intergenic
909037820 1:70614479-70614501 TCTAGGAATTTTATGGTTTTAGG - Intergenic
909207347 1:72776178-72776200 TCCTGTACTTTTAAGGCCTTGGG + Intergenic
909303769 1:74046477-74046499 TCTAGGGTTTTTATGGCTTTAGG - Intronic
909341176 1:74532944-74532966 TCTAGGGCTTTTATGGTTTTAGG - Intronic
909414260 1:75387089-75387111 TCTAGGATTTTTATGGTTTTAGG - Intronic
909416126 1:75407740-75407762 TCTAGGATTTTTATGGTCTTAGG - Intronic
909513695 1:76483833-76483855 TCCAGGGTTTTTATGGTTTTAGG + Intronic
909557073 1:76965719-76965741 TCTAGGATTTTTATGGTTTTAGG + Intronic
909685533 1:78344122-78344144 TCTAGGATTTTTATGGCTTTAGG + Intronic
909734093 1:78934432-78934454 TCTAGGAGTTTTATGGTTTTGGG - Intronic
909807467 1:79889671-79889693 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
909850715 1:80459801-80459823 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
910111241 1:83685626-83685648 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
910124536 1:83825914-83825936 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
910275289 1:85443138-85443160 TCTAGGATTTTTATGGTTTTAGG + Intronic
910331439 1:86076872-86076894 TCTAGGACTTTTATGGTTTCAGG - Intronic
910335174 1:86120171-86120193 TCTAGGATTTTTATGGTTTTAGG - Intronic
910338887 1:86163462-86163484 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
910385397 1:86677287-86677309 TCCAGGACTTTTTTTTAATTTGG - Intergenic
910560722 1:88587638-88587660 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
910635202 1:89400299-89400321 TCAAGGATTTTTATGGTTTTAGG + Intergenic
910666955 1:89735685-89735707 TCCAGGATTTTGATGCCAATTGG + Intronic
910827358 1:91423486-91423508 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
911074580 1:93860739-93860761 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
911144462 1:94539384-94539406 GCCAGGCCTTTTACAGCATTAGG - Intronic
911311720 1:96300935-96300957 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
911338814 1:96612843-96612865 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
911416762 1:97584522-97584544 TCCAGGGTTTTTATGGTTTTAGG + Intronic
911458679 1:98161070-98161092 TCTAGGATTTTTATGGTTTTAGG - Intergenic
911495756 1:98629314-98629336 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
911537081 1:99113277-99113299 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
911667767 1:100573327-100573349 TCCAGGATTTTTATAGTTTTGGG - Intergenic
911892159 1:103385142-103385164 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
912027104 1:105190617-105190639 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
912069263 1:105787566-105787588 TCTAGGGATTTTATGGCTTTAGG - Intergenic
912213816 1:107584287-107584309 TCTAGGGCTTTTATGGTTTTAGG - Intronic
912284405 1:108353567-108353589 TCTAGAACTTTTATGGTTTTAGG + Intergenic
912590201 1:110810603-110810625 TCTAGGAGTTTTATGGTCTTAGG - Intergenic
912611806 1:111054856-111054878 TCCAGGATTTTAATGGCTTCAGG + Intergenic
912732540 1:112121647-112121669 TCCAGGATTTTTCTAGTATTGGG - Intergenic
913029801 1:114889814-114889836 TCCAGGGTTTTTATGGTTTTAGG + Intronic
913418972 1:118642782-118642804 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
913455400 1:119025513-119025535 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
913694416 1:121310536-121310558 TCCAGGGTTTTTATGGTTTTAGG + Intronic
913710873 1:121482142-121482164 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
913719671 1:121579291-121579313 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
914329360 1:146651677-146651699 TCCAGGATTTTTATAGTTTTAGG - Intergenic
914459151 1:147866624-147866646 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
914842131 1:151257054-151257076 TCCAGGATTTTTATAGTTTTGGG + Intronic
914998969 1:152570592-152570614 TTCAAGACTATTATGGCACTGGG + Intronic
915045067 1:153005734-153005756 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
915871903 1:159570062-159570084 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
916386305 1:164274865-164274887 TCTAAGAGTTTTATGGCTTTAGG - Intergenic
916645378 1:166779676-166779698 TCTAGGATTTTTATGGCTCTAGG + Intergenic
916909775 1:169334592-169334614 TCCAGGGTTTTTATGGTTTTGGG - Intronic
916973913 1:170053872-170053894 TCTAGGGTTTTTATGGCTTTGGG - Intronic
916984057 1:170171481-170171503 TCCAGGATTTTTATAGTTTTGGG + Intergenic
917289426 1:173456992-173457014 TCTAGGATTTTTATGGTGTTAGG - Intergenic
917393196 1:174561884-174561906 TCTAGGATTTTTATGGTTTTAGG - Intronic
917400713 1:174646323-174646345 TCTAGGATTTTTATGGTTTTAGG + Intronic
917712265 1:177697536-177697558 TCTAGGATTTTTATGGTTTTAGG - Intergenic
917915705 1:179699322-179699344 TCTAGGATTTTTATGGTTTTAGG - Intergenic
917998346 1:180465061-180465083 TCCAGGGTTTTTATGGTTTTGGG - Intronic
918165757 1:181945980-181946002 TCCAGGATTTTTATGGTTTTGGG - Intergenic
918467425 1:184834954-184834976 TCCAGGGTTTTTATGGTTTTAGG + Intronic
918525512 1:185460123-185460145 TCTAGGATTTTTATGGTTTTAGG - Intergenic
918542033 1:185642937-185642959 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
918655719 1:187023731-187023753 TCTAGGATTTTTATGGTTTTAGG - Intergenic
918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG + Intergenic
918821526 1:189261625-189261647 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
918854019 1:189727656-189727678 TCCAGGGTTTTTATAGTATTGGG + Intergenic
918860109 1:189813583-189813605 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
918919684 1:190692418-190692440 TCTAGGATTTTTATGGTTTTAGG - Intergenic
918930724 1:190853246-190853268 TCCAGGATTTTTATGGTATAAGG + Intergenic
918936933 1:190932789-190932811 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
919053311 1:192538125-192538147 TCTAGGATTTTTATGGTACTAGG - Intergenic
919099355 1:193074845-193074867 TCTAGGGCTTTTATGGTTTTAGG + Intronic
919259865 1:195178471-195178493 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
919285447 1:195552884-195552906 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
919289824 1:195615142-195615164 TCTAGGATTTTTATGGTTTTAGG + Intergenic
919321494 1:196046619-196046641 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
919326219 1:196110280-196110302 TCTAGGATTTTTATGGTTTTAGG - Intergenic
919511847 1:198474879-198474901 TCTAGGATTTTTATGGTTTTAGG + Intergenic
919608353 1:199714305-199714327 TCCAGGGCTTTTATTGTTTTTGG - Intergenic
920619524 1:207530677-207530699 TCTAGGATTTTTATGGTTTTAGG + Intronic
920621306 1:207549232-207549254 TCTAGGATTTTTATGGTTTTAGG + Intronic
920894996 1:210039413-210039435 TCTAGGGCTTTTATGGTTTTAGG - Intronic
920935107 1:210425453-210425475 TCCAGGATTTTTATAGTTTTGGG + Intronic
920994116 1:210970668-210970690 TCCAGTATTTTTATGGTTTTGGG - Intronic
921351191 1:214237268-214237290 TCCAGGACTTTTATAGTTTTAGG + Intergenic
921659368 1:217781129-217781151 TCCATGACTTTTATGGTAACTGG + Intronic
921717071 1:218428447-218428469 TCTAGGGCTTTTATGGTTTTAGG + Intronic
921843559 1:219855016-219855038 TCCAGGGTTTTTATGGTTTTAGG + Intronic
921879942 1:220244853-220244875 TCCAGGATTTTTATGGTTTCAGG - Intronic
921915562 1:220606637-220606659 TCTAGGGCTTTTATGGTTTTAGG + Intronic
921947794 1:220898575-220898597 TCCAGGATTTTTATGGTCCTAGG + Intergenic
922066674 1:222150704-222150726 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
922373922 1:224941620-224941642 TCCAGGGTTTTTATGGTTTTAGG + Intronic
922826228 1:228521806-228521828 TCTAGGATTTTTATGGTTTTAGG + Intergenic
923067333 1:230530560-230530582 TCTAGAATTTTTATGGTATTGGG - Intergenic
923690429 1:236187442-236187464 TCTAGGATTTTTATGGTTTTAGG + Intronic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
923871783 1:238003089-238003111 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
923930255 1:238686274-238686296 TTCAGGATTTTTATAGCTTTGGG - Intergenic
924206859 1:241720906-241720928 TCTAGGTCTTTTATGGTTTTGGG + Intronic
924311628 1:242749677-242749699 TCTAGGATTTTTATGGTTTTAGG + Intergenic
924491347 1:244541035-244541057 TCCAGGGTTTTTATGGTTTTAGG - Intronic
924576007 1:245281717-245281739 TCCAGGGTTTTTATGGTTTTAGG + Intronic
924731831 1:246719216-246719238 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
924790292 1:247240271-247240293 TCTAGGATTTTTATGGTTTTAGG - Intergenic
924911213 1:248515221-248515243 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
924912888 1:248532819-248532841 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
924924869 1:248670469-248670491 CCCAGGACTTATATGCCATAGGG - Intergenic
1063324522 10:5084189-5084211 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1063528308 10:6805255-6805277 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1063840819 10:10070486-10070508 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1064492429 10:15873633-15873655 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1064501860 10:15982192-15982214 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1064789035 10:18934667-18934689 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1065091677 10:22241378-22241400 TCTAAGAGTTTTATGGCTTTAGG - Intergenic
1065253930 10:23845843-23845865 TCTAGGATTTTTATGGTTTTAGG + Intronic
1065255930 10:23867963-23867985 TCTAGGATTTTTATGGTTTTAGG + Intronic
1065272588 10:24050417-24050439 TCTAGGATTTTTATGGTTTTAGG + Intronic
1065335659 10:24655149-24655171 TCTAGGATTTTTATGGTTTTAGG - Intronic
1065372667 10:25004872-25004894 TCCAGGATTTTTATAGTTTTGGG + Intronic
1065405643 10:25360362-25360384 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1065652372 10:27905896-27905918 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1065992458 10:31026118-31026140 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1066163454 10:32759623-32759645 TCTAGGGTTTTTATGGTATTAGG - Intronic
1066221536 10:33339511-33339533 TCCTTGACTTTTATGACAATAGG - Intergenic
1066298005 10:34072482-34072504 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1066483101 10:35816498-35816520 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1066495703 10:35939831-35939853 TTCAGGATTTGTGTGGCATTAGG - Intergenic
1066655675 10:37697845-37697867 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1066965342 10:42258886-42258908 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1067172120 10:43915910-43915932 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1067240796 10:44491190-44491212 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1067252474 10:44599193-44599215 TCTAGGACTTTTATAGTTTTGGG - Intergenic
1067675873 10:48376267-48376289 TCTAGGATTTTTATGGTTTTAGG - Intronic
1067845797 10:49719925-49719947 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1068057155 10:52025438-52025460 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1068125941 10:52842018-52842040 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1068152174 10:53146498-53146520 TCTAGGGCTTTTATGGTTTTGGG + Intergenic
1068441521 10:57061431-57061453 TCCAGTATTTTTATGGTTTTGGG - Intergenic
1068442635 10:57078355-57078377 TCCAGGGATTTTATGGTTTTAGG + Intergenic
1068528241 10:58155649-58155671 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1068788702 10:61004028-61004050 TCTAGGGATTTTATGGCTTTAGG + Intergenic
1068821404 10:61380558-61380580 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1068822460 10:61393078-61393100 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1068979787 10:63050320-63050342 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1069066336 10:63945752-63945774 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1069067766 10:63961768-63961790 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1069194110 10:65527242-65527264 TCCAGGGCTTTTATGATTTTAGG - Intergenic
1069198848 10:65588220-65588242 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1069263556 10:66430782-66430804 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1069263850 10:66433754-66433776 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1069265123 10:66447705-66447727 TCTAGGATTTTTATGGTTTTAGG - Intronic
1069353545 10:67558041-67558063 TCCAAGACTCTTCTTGCATTTGG - Intronic
1069367888 10:67712813-67712835 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1070054046 10:72917272-72917294 TCCAGGATTTTTATAGTTTTGGG + Intronic
1070701748 10:78607288-78607310 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1070937204 10:80309054-80309076 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1071000161 10:80822686-80822708 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1071006158 10:80886476-80886498 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1071079794 10:81797450-81797472 TCCAGACCTTTTTTAGCATTTGG + Intergenic
1071256573 10:83877189-83877211 TCCAGGGCTACTATGGCATGAGG - Intergenic
1071277779 10:84071696-84071718 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1071418902 10:85469114-85469136 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1071696026 10:87872530-87872552 TGCAGGACTTTTTTGGCACTTGG + Intronic
1071889849 10:89991904-89991926 TATAGTAGTTTTATGGCATTAGG - Intergenic
1072379053 10:94848189-94848211 TCTAGGATTTTTATGGTTTTAGG + Intronic
1072384736 10:94913080-94913102 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1072407005 10:95164454-95164476 TCTAGGACTTTTATGGTTTTAGG - Intergenic
1072479958 10:95801310-95801332 TCCAGGATTTTTATGGTTTTGGG + Intronic
1072560991 10:96573954-96573976 TCTAGGATTTTTATGGTTTTAGG - Intronic
1072834915 10:98700523-98700545 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1072838088 10:98738355-98738377 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1073500827 10:103935441-103935463 TCCAGGGCTTTTATAGCTTTGGG - Intergenic
1073602358 10:104859447-104859469 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1073719527 10:106151377-106151399 TCTAGGAATTTTATGGCTTCTGG - Intergenic
1073728151 10:106258588-106258610 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1073975557 10:109096802-109096824 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1074003802 10:109398494-109398516 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1074005250 10:109415413-109415435 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1074179687 10:111048147-111048169 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1074215732 10:111381888-111381910 TCCAGGACTTTTATGGGCTCAGG + Intergenic
1074660316 10:115647907-115647929 TCTAGGATTTTTATGGTTTTAGG + Intronic
1075439647 10:122469527-122469549 TCCAGGACAGTTAGGGCAGTGGG + Intronic
1076074190 10:127519950-127519972 TCCAGGGCTTTTATAGTTTTAGG - Intergenic
1077731971 11:4741026-4741048 TCTAGGGATTTTATGGCTTTGGG + Intronic
1077775110 11:5262255-5262277 TCTAGGATTTTTATGGTTTTAGG - Intronic
1077895905 11:6453130-6453152 TGCAGCACTGATATGGCATTTGG + Intronic
1077933974 11:6763377-6763399 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1077984401 11:7336451-7336473 TCCAGGATTTTTATAGTTTTGGG + Intronic
1078587707 11:12608080-12608102 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
1078640260 11:13088420-13088442 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1078681812 11:13484252-13484274 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1078698208 11:13656273-13656295 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1078833258 11:14997192-14997214 TCTAGGATTTTTATGGTTTTAGG - Intronic
1078946690 11:16076140-16076162 TCCAGGATTTTTATAGTTTTAGG - Intronic
1079548874 11:21670159-21670181 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1079804861 11:24917446-24917468 TCTAGGATTTTTATGGTTTTAGG + Intronic
1080095359 11:28399328-28399350 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1080175347 11:29356544-29356566 TCTAGGGTTTTTATGGCTTTGGG + Intergenic
1080246368 11:30183473-30183495 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1080489018 11:32742767-32742789 TCCAGGATTTTTATGGTCCTAGG + Intronic
1080683095 11:34494175-34494197 CCCAGGACTATTATGGAGTTTGG + Intronic
1080709098 11:34729117-34729139 TCCAGGATTTTTATAGCTTGAGG + Intergenic
1080737146 11:35027405-35027427 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1080810448 11:35698896-35698918 TCTAGGATTTTTATGGTTTTAGG + Intronic
1080811389 11:35707792-35707814 TCTAGGATTTTTATGGTTTTAGG - Intronic
1081168782 11:39840680-39840702 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1081272400 11:41101033-41101055 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1081277694 11:41170634-41170656 TCTAGGATTTTTATGGTTTTAGG - Intronic
1081836138 11:46156389-46156411 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1082157858 11:48848806-48848828 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1082158457 11:48854462-48854484 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1082233217 11:49794268-49794290 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1082248068 11:49948123-49948145 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1082266329 11:50122505-50122527 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1082269678 11:50156405-50156427 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1082289760 11:50356067-50356089 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1082303974 11:50547935-50547957 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1082578914 11:54842876-54842898 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1082600015 11:55137720-55137742 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1082638009 11:55620247-55620269 TCAAGGGTTTTTATGGTATTAGG + Intergenic
1082712304 11:56567818-56567840 TCCAGGATTTTTATAGCTTTAGG + Intergenic
1082871684 11:57948659-57948681 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1082876642 11:57995274-57995296 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1082925071 11:58536538-58536560 TCTAGGAATTTTATGGTTTTAGG - Intronic
1083025165 11:59544645-59544667 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1083080332 11:60085798-60085820 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1083502753 11:63126270-63126292 TCTAGGATTTTTATGGTTTTAGG + Intronic
1083503061 11:63129087-63129109 TCTAGGGCTTTTATGGTGTTAGG + Intronic
1083553755 11:63609789-63609811 TCCAGGATGTTTATGACCTTTGG - Intronic
1083711035 11:64548452-64548474 TCCAGGACTTCTCTGGCTTCAGG - Intergenic
1085223068 11:74892434-74892456 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1085378741 11:76092947-76092969 TCTAGGATTTTTATGGTTTTAGG + Intronic
1085490679 11:76914078-76914100 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1085611230 11:77951542-77951564 TCTAGGATTTTTATGGTTTTAGG - Intronic
1085964253 11:81501442-81501464 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1085979237 11:81702396-81702418 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1086111350 11:83202104-83202126 TCTAGGGCTTTTATGGGTTTAGG + Intronic
1086187808 11:84040332-84040354 TCTAGGATTTTTATGGTTTTAGG + Intronic
1086211400 11:84324171-84324193 TCCAGGAGTTTTATAGTTTTAGG + Intronic
1086254662 11:84861517-84861539 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1086267652 11:85020572-85020594 TCCAGGATTTTTATGGTTTTAGG + Intronic
1086271217 11:85069181-85069203 TCTAGGATTTTTATGGTTTTAGG - Intronic
1086409591 11:86530878-86530900 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1086645436 11:89213971-89213993 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1086687449 11:89749083-89749105 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1086777642 11:90859405-90859427 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1086786987 11:90980999-90981021 TCCAGGGCTTTTATAGTCTTGGG + Intergenic
1086788035 11:90996376-90996398 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1086789400 11:91016781-91016803 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1086871579 11:92043933-92043955 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1086877739 11:92117362-92117384 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1086985645 11:93246199-93246221 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1087004357 11:93454385-93454407 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1087060882 11:93976441-93976463 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1087311573 11:96550040-96550062 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1087414026 11:97829689-97829711 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1087422722 11:97950525-97950547 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1087521895 11:99248574-99248596 TCTAGGATTTTTATGGTTTTAGG + Intronic
1087572986 11:99953952-99953974 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1087596592 11:100261827-100261849 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1087815160 11:102650132-102650154 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1087972339 11:104500011-104500033 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1088038137 11:105343232-105343254 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1088161550 11:106877655-106877677 TCCAGGGTTTTTATGGTTTTGGG - Intronic
1088301389 11:108361827-108361849 TCTAGGGTTTTTATGGTATTAGG - Intronic
1088307621 11:108427068-108427090 TCTAGGATTTTTATGGTTTTAGG - Intronic
1088405345 11:109470023-109470045 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1088420438 11:109639262-109639284 TCCAGGGCTTTTACGGTTTTGGG + Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1089090168 11:115866835-115866857 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1089102111 11:115971982-115972004 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1089106417 11:116009922-116009944 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1090318840 11:125822963-125822985 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1090525806 11:127534338-127534360 TCCAGGAGTTTTACAGCTTTAGG + Intergenic
1090587046 11:128224130-128224152 TCTAGGACTTTTATAGTTTTGGG - Intergenic
1091052902 11:132390049-132390071 TATATGACTTTTATTGCATTGGG - Intergenic
1092328878 12:7564276-7564298 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1092394712 12:8115468-8115490 ACCAGGACTTCAATGGCATGAGG + Intergenic
1092550692 12:9496023-9496045 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1092577524 12:9803340-9803362 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1092585032 12:9890974-9890996 TCAAAGACTTTAATTGCATTTGG + Intronic
1092594676 12:9988243-9988265 TCTAGGATTTTTATGGTTTTAGG - Intronic
1092703700 12:11261344-11261366 TCCAGGGTTTTTATGGTTTTTGG - Intergenic
1093092848 12:14940571-14940593 TCTAGGACTTTTATGGTTTGAGG - Intergenic
1093104604 12:15070954-15070976 TCAAGGGTTTTTATGGCTTTAGG - Intergenic
1093217249 12:16378258-16378280 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1093330603 12:17833487-17833509 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1093403843 12:18780510-18780532 TCTAGGGCTTTTATGGCTTTGGG - Intergenic
1093491920 12:19714762-19714784 TCCAGGATTTTTATAGTTTTGGG + Intronic
1093579817 12:20773972-20773994 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1093632310 12:21424099-21424121 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1093678070 12:21967236-21967258 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1094206589 12:27846697-27846719 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1094281071 12:28739271-28739293 TCCAGGAGTTTTATGGCACCTGG + Intergenic
1094305816 12:29017847-29017869 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1094521124 12:31190345-31190367 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1094521217 12:31191265-31191287 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1094758342 12:33497977-33497999 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1094816923 12:34196584-34196606 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1095100119 12:38172497-38172519 TCCAGGACTTTTATAGTTCTGGG + Intergenic
1095119912 12:38405009-38405031 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1095128875 12:38513653-38513675 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1095160503 12:38908586-38908608 TCCAAGACCTTTATCGCATGTGG + Intergenic
1095439130 12:42225490-42225512 TCCAGGGATTTTATGGTTTTAGG + Intronic
1095610630 12:44123512-44123534 TCCAGGGTTTTTATAGCTTTGGG + Intronic
1095652989 12:44635394-44635416 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1095720662 12:45396864-45396886 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1096126159 12:49121328-49121350 GCCAGGAGTTTGATGGGATTGGG + Intergenic
1096432705 12:51560699-51560721 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1096898638 12:54851271-54851293 TCTAGGATTTTTATGGTTTTAGG + Intronic
1096946814 12:55415506-55415528 TCCAGGGCTTTTATAGTTTTAGG + Intergenic
1096952570 12:55488903-55488925 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1096963368 12:55603085-55603107 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1097253228 12:57651364-57651386 TCTAGGGTTTTTATGGGATTAGG - Intergenic
1097500480 12:60394296-60394318 TCCAGTAATTTTATGACAATGGG + Intergenic
1097508243 12:60503468-60503490 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1097562264 12:61221999-61222021 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1097620022 12:61928040-61928062 TCTAGGATTTTTATGGTTTTAGG - Intronic
1097634761 12:62109091-62109113 TCTAGGATTTTTATGGTTTTAGG + Intronic
1097721961 12:63031398-63031420 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1097838556 12:64298492-64298514 TCTAGGACTTTTATGGTTTTAGG + Intronic
1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG + Intergenic
1098327595 12:69318510-69318532 TCCAGGGCTTTTATAGTTTTTGG + Intergenic
1098434645 12:70455579-70455601 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1098507061 12:71265175-71265197 TCTAGGATTTTTATGGTTTTAGG - Intronic
1098684338 12:73399698-73399720 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1098688933 12:73462722-73462744 TCCAGGGCTTTTATAGTTTTAGG + Intergenic
1098780607 12:74681407-74681429 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1098858481 12:75681237-75681259 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1099086518 12:78253150-78253172 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1099235001 12:80073236-80073258 TCTAGGATTTTTATGGATTTAGG + Intergenic
1099489282 12:83268502-83268524 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1099489681 12:83273082-83273104 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1099502147 12:83427142-83427164 TCCAGGATTTTTATGGTTTTGGG + Intergenic
1099515722 12:83594577-83594599 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1099524234 12:83699395-83699417 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1099540261 12:83899507-83899529 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1099562599 12:84196909-84196931 TCCAGGGATTTTATGGTTTTTGG - Intergenic
1099626994 12:85088057-85088079 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1099667308 12:85648805-85648827 TCCAGGGTTTTTATAGTATTAGG + Intergenic
1099678308 12:85790429-85790451 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1099749993 12:86761390-86761412 TCCACTACTTTTGTGGCAATAGG - Intronic
1099809365 12:87561199-87561221 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1099860600 12:88221156-88221178 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1099862750 12:88240327-88240349 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1100087443 12:90929060-90929082 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1100108508 12:91207861-91207883 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1100128631 12:91461980-91462002 TCTAGGTCTTTTATGGTTTTAGG - Intergenic
1100266683 12:92983763-92983785 TCTAGGGCTTTTATAGCTTTAGG - Intergenic
1100740539 12:97586707-97586729 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1100876288 12:98965927-98965949 TCTAGGGTTTTTATGGTATTAGG - Intronic
1100901230 12:99242922-99242944 TCTAGGATTTTTATGGTGTTAGG - Intronic
1100924441 12:99528253-99528275 TCCAGGGTTTTTATGGATTTAGG - Intronic
1100933162 12:99633515-99633537 TCTAGGATTTTTATGGTTTTAGG - Intronic
1101069382 12:101057974-101057996 TCTAGGATTTTTATGGTTTTAGG + Intronic
1101088682 12:101262211-101262233 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1101100854 12:101391068-101391090 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1101103029 12:101413237-101413259 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1101464393 12:104932912-104932934 TCTAGAATTTTTATGGCTTTAGG - Intronic
1101636479 12:106547023-106547045 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1102322626 12:111950711-111950733 TCCAGGATTTTTATAGTTTTGGG - Intronic
1104086739 12:125482133-125482155 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1104246714 12:127049667-127049689 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1104673771 12:130698609-130698631 TCTAGGATTTTTATGGTTTTAGG - Intronic
1104677739 12:130725609-130725631 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1105660848 13:22493264-22493286 TCTAGGGTTTTTATGGTATTGGG + Intergenic
1105749094 13:23405436-23405458 TCTAGGATTTTTATGGTTTTAGG - Intronic
1106305233 13:28503866-28503888 TCCAGGTCTCTGATGGGATTGGG + Intergenic
1106767698 13:32931449-32931471 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1106856209 13:33856080-33856102 TCCAGGGTTTTTATAGCTTTGGG + Intronic
1106980643 13:35275383-35275405 TCCAGGGTTTTTATGGTGTTAGG - Intronic
1108132304 13:47315796-47315818 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1108143531 13:47451957-47451979 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1108198232 13:48016674-48016696 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1108384298 13:49884722-49884744 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1108449459 13:50546610-50546632 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1108536064 13:51380671-51380693 TGCAGGAATATTATAGCATTTGG - Intronic
1108549682 13:51531391-51531413 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1108892045 13:55273642-55273664 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1108977952 13:56472923-56472945 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1108998762 13:56768236-56768258 TCTAGGAATTTTATGGTTTTAGG - Intergenic
1109020211 13:57081436-57081458 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1109294071 13:60508648-60508670 TCTAGGATTTTTATGGTTTTAGG - Intronic
1109372411 13:61440554-61440576 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1109374888 13:61479554-61479576 TCCAGAATTTTTATAGCTTTAGG + Intergenic
1109592449 13:64503743-64503765 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1109661250 13:65463428-65463450 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1109799037 13:67350440-67350462 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1109804415 13:67419280-67419302 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1109849347 13:68039792-68039814 TCCACCCCTTTTATGACATTAGG + Intergenic
1109930126 13:69205467-69205489 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1109944603 13:69417229-69417251 TTGAGAAGTTTTATGGCATTTGG + Intergenic
1109964954 13:69680094-69680116 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1110022916 13:70498500-70498522 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1110327720 13:74237053-74237075 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1110349917 13:74494967-74494989 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1110353736 13:74541244-74541266 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1110476372 13:75919101-75919123 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1110488822 13:76078722-76078744 TCTAGGATTTTTATGGCTTTGGG - Intergenic
1110491207 13:76110251-76110273 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1110737011 13:78948929-78948951 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1110861759 13:80351792-80351814 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1111092639 13:83466828-83466850 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1111234309 13:85389041-85389063 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1111322274 13:86646717-86646739 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1111327880 13:86722944-86722966 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
1111391754 13:87605599-87605621 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1111466082 13:88612437-88612459 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1111576466 13:90160960-90160982 TCCAGGGTTTTTATAGCTTTTGG - Intergenic
1111782244 13:92742693-92742715 TCCAGGGTTTTTATGGGTTTAGG + Intronic
1111861944 13:93718717-93718739 TCTAGGATTTTTATGGTTTTAGG + Intronic
1111967533 13:94876106-94876128 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1112081539 13:95977079-95977101 TCTAGGATTTTTATGGTTTTAGG - Intronic
1112117499 13:96372595-96372617 TCTAGGAATTTTATGGATTTAGG + Intronic
1112171704 13:96979251-96979273 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1112581229 13:100678096-100678118 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1112671332 13:101642675-101642697 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1112736212 13:102422132-102422154 TCCAGGACTTTTATAGTTTTGGG - Intergenic
1113173687 13:107536106-107536128 TCTAGGATTTTTATGGTTTTAGG - Intronic
1114094475 14:19320315-19320337 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1114686845 14:24540866-24540888 TCCAGGGTTTTTATAGCTTTAGG - Intergenic
1114706423 14:24731525-24731547 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1114708374 14:24751070-24751092 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1114796263 14:25718640-25718662 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1114797976 14:25738772-25738794 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1115281011 14:31663350-31663372 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1115390750 14:32852271-32852293 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1115704214 14:35981811-35981833 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1115802938 14:37016154-37016176 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1115833798 14:37374496-37374518 TCTAGGATTTTTATGGTGTTAGG + Intronic
1115893394 14:38057848-38057870 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1115947265 14:38676177-38676199 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1115950461 14:38715334-38715356 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1116029285 14:39551315-39551337 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1116156281 14:41210450-41210472 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1116161991 14:41279246-41279268 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1116165133 14:41325489-41325511 TCCAGGGTTTTTATGGTGTTAGG + Intergenic
1116230207 14:42206017-42206039 TCTAGGATTTTTATGGATTTAGG + Intergenic
1116262219 14:42645000-42645022 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1116275834 14:42830074-42830096 TCCAGAGCTTTTATGGTTTTAGG - Intergenic
1116331479 14:43602268-43602290 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1116339523 14:43703534-43703556 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1116354034 14:43904954-43904976 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1116372938 14:44159145-44159167 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1116488093 14:45475653-45475675 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1116550116 14:46226812-46226834 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1116560476 14:46372695-46372717 TCCAGGTTTTTTATGGTTTTGGG + Intergenic
1116650992 14:47592765-47592787 TCCAGGGTTTTTATAGCTTTCGG - Intronic
1116704603 14:48281008-48281030 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1117123227 14:52591936-52591958 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1117614012 14:57514582-57514604 TCTAGGATTTTTATGGTGTTAGG + Intergenic
1117614704 14:57521679-57521701 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1117636091 14:57745112-57745134 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1117859842 14:60078325-60078347 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1118088660 14:62447468-62447490 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1118325990 14:64781103-64781125 TCCAGGCCTTTTATAGTTTTGGG - Intronic
1118504561 14:66396860-66396882 TCCAGGGGTTTTATGGTTTTAGG - Intergenic
1118559440 14:67063032-67063054 TCTAGGATTTTTATGGTTTTAGG + Intronic
1118931162 14:70242238-70242260 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1119311990 14:73655285-73655307 TCCAGCAATTTTATAGCAATAGG - Intronic
1120042800 14:79772656-79772678 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1120118741 14:80652222-80652244 TCTAGGATTTTTATGGTTTTAGG - Intronic
1120247555 14:82024969-82024991 TCTAGGGCTTTTATGGTTTTGGG + Intergenic
1120526720 14:85584998-85585020 TCGAGGGCTTTTGTGGCATGAGG + Intronic
1120553669 14:85903027-85903049 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1120564898 14:86043445-86043467 TCCAGGGTTTTTATGGTTTTTGG + Intergenic
1120666804 14:87315980-87316002 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1120675281 14:87414659-87414681 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1202847625 14_GL000009v2_random:194868-194890 TCCAAGATTTTTATGGTTTTAGG - Intergenic
1202880812 14_KI270722v1_random:58124-58146 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1123225329 15:17018611-17018633 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1123428779 15:20196027-20196049 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1124090548 15:26595872-26595894 TCCAGGGCTTATATAGCATAGGG - Intronic
1124502492 15:30241474-30241496 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1124667195 15:31603473-31603495 TCTAGGATTTTTATGGTTTTAGG - Intronic
1124741072 15:32297175-32297197 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1124790915 15:32725748-32725770 TCTAGGATTTTTATGGTTTTAGG + Intronic
1125227694 15:37413405-37413427 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1125232806 15:37476050-37476072 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1125235414 15:37507183-37507205 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1125254212 15:37744786-37744808 TCCAGATCTTTTCTGGGATTGGG - Intergenic
1125359841 15:38853452-38853474 TCCAGGGATTTTATGGTTTTAGG - Intergenic
1126162218 15:45624175-45624197 TCTAGGATTTTTATGGTTTTAGG - Intronic
1126177740 15:45753621-45753643 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1126470256 15:49002563-49002585 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1126528153 15:49681254-49681276 TCTAGGACTTTTATGGCTTCAGG - Intergenic
1126656676 15:50985421-50985443 TCTAGGATTTTTATGGTTTTAGG + Intronic
1126818092 15:52473506-52473528 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1126853586 15:52815628-52815650 TCAAGGGCTTCTATTGCATTTGG - Intergenic
1126854903 15:52829014-52829036 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1126934306 15:53689094-53689116 TCCAGGATTTTTATGGTTTTAGG - Intronic
1126972022 15:54126588-54126610 TCTAGGATTTTTATGGTTTTAGG - Intronic
1127042805 15:54995838-54995860 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1127125491 15:55807654-55807676 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1127154816 15:56112534-56112556 TCTAGGATTTTTATGGTTTTGGG - Intronic
1127168841 15:56277285-56277307 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1127179891 15:56404011-56404033 TCCAGGGATTTTATGGTTTTAGG - Intronic
1127194164 15:56566446-56566468 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1127212556 15:56788958-56788980 TCTAGGGTTTTTATGGTATTAGG - Intronic
1127227948 15:56954450-56954472 TCTAGGATTTTTATGGTTTTAGG - Intronic
1127317393 15:57810253-57810275 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1127580490 15:60334736-60334758 TCTAGGGCTTTTATGGTGTTAGG - Intergenic
1128012652 15:64312634-64312656 TCTAGGATTTTTATGGCTTTAGG - Intronic
1129134599 15:73536055-73536077 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1129135622 15:73547805-73547827 TCCAGCATTTTTATAGCGTTTGG - Intronic
1129585176 15:76855305-76855327 TCCAGGATTTTTATAGTTTTGGG - Intronic
1129954169 15:79619091-79619113 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1130138631 15:81203433-81203455 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1130158456 15:81374381-81374403 TCCAGGACTGTCAGGGCATAAGG - Intergenic
1130180975 15:81628102-81628124 TCTAGGTTTTTTATGGCGTTAGG - Intergenic
1130453112 15:84077415-84077437 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1130737047 15:86561269-86561291 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1130786113 15:87098636-87098658 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1130825351 15:87539338-87539360 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1131284618 15:91046900-91046922 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1131834882 15:96380588-96380610 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1131917123 15:97279842-97279864 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1131930697 15:97437723-97437745 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1131936586 15:97512771-97512793 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1132262196 15:100435502-100435524 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1132445641 15:101915503-101915525 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1132991004 16:2793904-2793926 TCTAGGAATTTTATGGCTTCAGG + Intergenic
1133157677 16:3887163-3887185 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1133458397 16:5963787-5963809 TCTAGGAGTCTTATGGCTTTAGG - Intergenic
1134312468 16:13087933-13087955 TCTAGGATTTTTATGGTTTTAGG + Intronic
1134792787 16:17005355-17005377 TCTAGGATTTTTATGGTTTTCGG + Intergenic
1134797004 16:17049630-17049652 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1134898422 16:17911424-17911446 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1135230586 16:20702924-20702946 TCCAGGGCTTTTATGGTTTTGGG + Intronic
1135232639 16:20723992-20724014 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1135897772 16:26424267-26424289 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1136325176 16:29518319-29518341 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1136439863 16:30258301-30258323 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1136743491 16:32561461-32561483 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1136772298 16:32851549-32851571 TCTAGGACTTTTATGGTTTTAGG - Intergenic
1136855543 16:33653716-33653738 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1136898314 16:34009972-34009994 TCTAGGACTTTTATGGTTTTAGG + Intergenic
1137079511 16:36028763-36028785 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1137336770 16:47557262-47557284 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1137412571 16:48241924-48241946 TCTAGGAATTTTATGGTTTTAGG - Intronic
1137471528 16:48763744-48763766 TCTAGGGCCTTTATGGCTTTAGG - Intergenic
1137889877 16:52148060-52148082 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1137894497 16:52196389-52196411 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1137969453 16:52969711-52969733 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1138705969 16:58915491-58915513 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1138797056 16:59981489-59981511 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1138926959 16:61604046-61604068 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1139183551 16:64775616-64775638 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1140004201 16:71059257-71059279 TCCAGGATTTTTATAGTTTTAGG + Intronic
1140623024 16:76759137-76759159 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1140695596 16:77529986-77530008 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1203026107 16_KI270728v1_random:513768-513790 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1203045614 16_KI270728v1_random:820663-820685 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1203074721 16_KI270728v1_random:1113638-1113660 TCTAGGACTTTTATGGTTTTAGG - Intergenic
1203117129 16_KI270728v1_random:1502197-1502219 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1142844398 17:2661273-2661295 TCTAGGATTTTTATGGTTTTGGG + Intronic
1143428256 17:6857940-6857962 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1144137368 17:12310051-12310073 TCCAGGGTTTTTATAGTATTAGG + Intergenic
1144600091 17:16604812-16604834 TCTAGGAATTTTATGGTTTTGGG + Intergenic
1144616179 17:16775816-16775838 TCCAGGATTTTTATAGTTTTGGG + Intronic
1145194753 17:20882055-20882077 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1146298060 17:31666025-31666047 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1146611148 17:34305977-34305999 CCCAGGACTTTTGTTGAATTTGG - Intergenic
1146740657 17:35280516-35280538 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1146745857 17:35329015-35329037 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1146766654 17:35528722-35528744 TCTAGGATTTTTATGGTTTTAGG - Intronic
1148867678 17:50637373-50637395 TCCAGGCCTTTTTTGTAATTAGG - Intronic
1149193390 17:54090640-54090662 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1149352359 17:55803739-55803761 TCCAGGGTTTTTATGGTTTTGGG - Intronic
1149507697 17:57209248-57209270 TCTAGAGCTTTTATAGCATTGGG - Intergenic
1150092967 17:62345904-62345926 TCCAGAATTTTTATGGATTTGGG + Intergenic
1150147912 17:62785405-62785427 TCTAGGATTTTTATGGTTTTAGG - Intronic
1150524214 17:65904982-65905004 TCTAGGATTTTTATGGGTTTAGG - Intronic
1150719218 17:67600001-67600023 TGTAGGTCTTTTATGGCAATAGG + Intronic
1150845652 17:68655251-68655273 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1151052149 17:70990497-70990519 TCTATAATTTTTATGGCATTGGG - Intergenic
1151163320 17:72184009-72184031 TCCAGGACATTTAGGGCACCAGG - Intergenic
1152326291 17:79640833-79640855 TCTAGTAGTTTTATGGCTTTGGG - Intergenic
1203167660 17_GL000205v2_random:112989-113011 TTTAGGTCTTTTATGACATTGGG - Intergenic
1153066890 18:1055996-1056018 TCTAGGAGTTTTATGGTTTTAGG + Intergenic
1153072686 18:1124007-1124029 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1153168380 18:2287664-2287686 TCCAGGGCTTTTATGGTTTGGGG + Intergenic
1153175907 18:2372869-2372891 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1153575759 18:6519217-6519239 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1153593960 18:6704821-6704843 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1153602933 18:6799742-6799764 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1153717398 18:7864308-7864330 TCTAGGATTTTTATGGTTTTAGG + Intronic
1153798890 18:8650896-8650918 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1154010978 18:10573782-10573804 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1154053869 18:10992342-10992364 TCTAGGATTTTTATGGTTTTAGG + Intronic
1154248529 18:12722204-12722226 TCCAGTATTTTTATGGCAGGAGG - Intronic
1154381790 18:13858401-13858423 TCCAGGATTTTTATGGTCCTGGG + Intergenic
1154414381 18:14167673-14167695 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1154459104 18:14561679-14561701 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1155105868 18:22665416-22665438 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1155127559 18:22894276-22894298 TCTAGGATTTTTATGGTTTTAGG - Intronic
1155375760 18:25155530-25155552 TCTAGGAATTTTATGGTTTTAGG + Intronic
1155661540 18:28254341-28254363 TCCAGGGTTTTTATGGCTTTGGG - Intergenic
1155687879 18:28577875-28577897 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1155760078 18:29554277-29554299 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1155794815 18:30022960-30022982 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1155911378 18:31508038-31508060 TCTAGGATTTTTATGGTTTTAGG + Intronic
1156038947 18:32797397-32797419 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1156166290 18:34425074-34425096 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1156191380 18:34725125-34725147 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1156238059 18:35223243-35223265 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1156321356 18:36027142-36027164 TCCAGAACTTTTTTGGGAGTTGG - Intronic
1156353089 18:36317838-36317860 TCTAGGATTTTTATGGTTTTAGG + Intronic
1156724837 18:40115190-40115212 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1156734047 18:40230928-40230950 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1156824380 18:41412876-41412898 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1156978895 18:43261690-43261712 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1157025733 18:43840501-43840523 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1157122975 18:44929042-44929064 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1157205963 18:45699473-45699495 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1157694649 18:49711591-49711613 TCTAGGATTTTTATGGTGTTAGG + Intergenic
1157787623 18:50499625-50499647 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1158221610 18:55156840-55156862 TCTAGGACTTTTATGGTTTTAGG - Intergenic
1158676131 18:59519783-59519805 TCTAGGATTTTTATGGTTTTAGG + Intronic
1158737626 18:60102082-60102104 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1159216570 18:65399650-65399672 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1159311889 18:66719973-66719995 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1159485187 18:69046705-69046727 TCCAGGGCTTTTATAGTTTTAGG + Intronic
1159645025 18:70907766-70907788 TCCTGGACTTAGATAGCATTGGG + Intergenic
1159749163 18:72279117-72279139 TCTAGGATTTTTATGGTTTTTGG - Intergenic
1159840678 18:73395039-73395061 TGAAGGACTCTTATGACATTGGG + Intergenic
1159984201 18:74822376-74822398 TCTAGGATTTTTATGGTTTTAGG + Intronic
1160068648 18:75604507-75604529 TCTAGGGCTTTTTTGGCTTTAGG - Intergenic
1160229983 18:77040810-77040832 TCTAGGAATTTTATGGTTTTAGG - Intronic
1160264422 18:77327453-77327475 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1160543204 18:79636899-79636921 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1161851923 19:6741733-6741755 TCCAGGGCTTTTTTGGATTTTGG - Intronic
1163194583 19:15706768-15706790 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1164035133 19:21447237-21447259 TCTAGGATTTTTATGGTCTTAGG + Intronic
1164246168 19:23431240-23431262 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1164323995 19:24176753-24176775 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1164326644 19:24198889-24198911 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1164347252 19:27281667-27281689 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1164350325 19:27329208-27329230 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1164360639 19:27504445-27504467 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1164367107 19:27597482-27597504 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1164440532 19:28274595-28274617 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1164543202 19:29137609-29137631 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1164717014 19:30399527-30399549 TCTAGGATTTTTATGGTTTTAGG + Intronic
1164977938 19:32588626-32588648 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1165270369 19:34701489-34701511 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1167869831 19:52358762-52358784 TCTAGGAGTTTTATGGTTTTAGG + Intronic
1202656422 1_KI270708v1_random:27231-27253 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
925598245 2:5579799-5579821 TCTAGGAGTTTTATAGTATTAGG - Intergenic
925672729 2:6328594-6328616 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
925792409 2:7505317-7505339 TGCAGGAATTGTATAGCATTTGG - Intergenic
925861676 2:8183580-8183602 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
925884849 2:8386147-8386169 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
926523933 2:13952559-13952581 TCTAGGATTTTTATGGTTTTAGG - Intergenic
926995855 2:18735186-18735208 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
927297821 2:21475475-21475497 TCTAGGATTTTTATGGTTTTAGG + Intergenic
927575081 2:24194530-24194552 TCTAGGATTTTTATGGTTTTAGG + Intronic
928060145 2:28104071-28104093 TCCAGGGTTTTTATGGTTTTAGG - Intronic
928472835 2:31590965-31590987 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
928475727 2:31625472-31625494 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
928576512 2:32660880-32660902 TCTAGGATTTTTATGGTTTTAGG + Intronic
929064284 2:37957756-37957778 TCTAGGGTTTTTATGGCTTTAGG + Intronic
929079945 2:38112314-38112336 TCTAGGGCTTTTATGGTTTTGGG + Intergenic
929669813 2:43866224-43866246 TCTAGGGCTTTTATGGTTTTAGG - Intronic
930050436 2:47211539-47211561 TCCAGGATTCTGATGGCATCAGG + Intergenic
930273478 2:49283781-49283803 TCTAGGATTTTTATGGTTTTAGG - Intergenic
930302593 2:49635886-49635908 TCCAGGATTTTTATAGTTTTAGG - Intergenic
930473645 2:51851854-51851876 TCTAGGATTTTTATGGTTTTAGG + Intergenic
930557620 2:52919117-52919139 TGCAGGATTTTCATGGCTTTAGG - Intergenic
930863329 2:56097581-56097603 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
930870202 2:56162911-56162933 TCTAGGATTTTTATGGTTTTAGG + Intergenic
930918725 2:56725000-56725022 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
930929776 2:56867608-56867630 TCTAGGATTTTTATGGTTTTAGG - Intergenic
930981019 2:57526036-57526058 TCCAGGATTTTTATGGTTTCTGG + Intergenic
930983808 2:57560446-57560468 TCTAGGATTTTTATGGTTTTAGG - Intergenic
931521418 2:63101318-63101340 TCCAGTAGTTTTATGGCTTGGGG + Intergenic
931532261 2:63229545-63229567 TCTAGGGCTTTTATGGTTTTAGG + Intronic
931558928 2:63535741-63535763 TCTAGGGCTTTTATGGTTTTAGG - Intronic
931889615 2:66656923-66656945 TCCAGGATTTTTATAGTTTTGGG + Intergenic
931935378 2:67190921-67190943 TCTAGGATTTTTATGGTTTTAGG + Intergenic
932006812 2:67935562-67935584 TCTAGGATTTTTATGGCCCTAGG - Intergenic
932077347 2:68677466-68677488 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
932540584 2:72647809-72647831 TCTAGGATTTTTATGGTTTTAGG - Intronic
932845053 2:75126521-75126543 TCCAGGGCTTTTATAGCTTTGGG - Intronic
932931115 2:76040558-76040580 TCTAGGACTTTTATGGTTTAAGG - Intergenic
932955451 2:76346278-76346300 TCTAGGATTTTTATGGTTTTAGG + Intergenic
933020353 2:77182963-77182985 TCTAGGGCTTTTATGGTTTTAGG - Intronic
933046559 2:77545222-77545244 TCCAGGGCTTTTATAGTTTTGGG - Intronic
933067120 2:77811385-77811407 TCTAGGGCTTTTTTGGTATTAGG - Intergenic
933101501 2:78264682-78264704 TCCAGGGCTTTTATAGTTTTAGG - Intergenic
933386531 2:81618200-81618222 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
933918429 2:87019870-87019892 TCTAGGACTCATATGGCAATAGG + Intronic
934004567 2:87750043-87750065 TCTAGGACTCATATGGCAATAGG - Intronic
934801809 2:97170581-97170603 TCTAGGGCTTTTATGGTTTTAGG - Intronic
934873799 2:97893989-97894011 TCTAGGATTTTTATGGTTTTAGG + Intronic
935419186 2:102849022-102849044 TCCAAGACTTTCCTGACATTTGG - Intergenic
935474733 2:103504692-103504714 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
935767521 2:106384065-106384087 TCTAGGACTCATATGGCAATAGG - Intergenic
935917981 2:107978495-107978517 TCCAGGATTTTTATGGTGCTAGG - Intergenic
935951922 2:108337596-108337618 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
936274443 2:111082049-111082071 TCTAGGATTTTTATGGTTTTAGG - Intronic
936377130 2:111950754-111950776 TCTAGGATTTTTATAGAATTGGG - Intronic
936624844 2:114137520-114137542 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
936823886 2:116556895-116556917 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
936829392 2:116624474-116624496 TCTAGGATTTTTATGGTTTTAGG - Intergenic
936853619 2:116931445-116931467 TCTAGGATTTTTATGGTTTTAGG - Intergenic
936908565 2:117566414-117566436 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
936995962 2:118414589-118414611 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
937143667 2:119623898-119623920 TCCAGGGTTTTTATGGTTTTAGG - Intronic
937464533 2:122120026-122120048 TCTAGGATTTTTATGGTTTTAGG + Intergenic
937586588 2:123558863-123558885 TCCAGAGTTTTTATAGCATTGGG + Intergenic
937715540 2:125027751-125027773 TCTAGGATTTTTATGGTTTTAGG + Intergenic
937757343 2:125556388-125556410 TCCAGGGATTTTAAGGAATTTGG + Intergenic
937779061 2:125816382-125816404 TCCAGGAGTCTTTTGGCATGGGG + Intergenic
937780444 2:125830548-125830570 TCTAGGACTTTTATGGTTTTAGG - Intergenic
938848556 2:135236819-135236841 TCTAGGGCTTTTATGGTTTTAGG - Intronic
939180831 2:138800950-138800972 TCCAGGGTTTTTATGGTTTTCGG - Intergenic
939206125 2:139106231-139106253 TCTAGGATTTTTATGGTTTTGGG + Intergenic
939226577 2:139372216-139372238 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
939261974 2:139822014-139822036 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
939270810 2:139937045-139937067 TCCAGTATTTTTATGGTTTTTGG + Intergenic
939329251 2:140736733-140736755 TCTAGGATTTTTATGGTTTTAGG - Intronic
939485540 2:142807383-142807405 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
939686806 2:145210442-145210464 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
939772077 2:146333811-146333833 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
940030048 2:149252416-149252438 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
940086549 2:149865667-149865689 TCTAGGATTTTTATGGTTTTAGG - Intergenic
940232470 2:151471481-151471503 TCTAGGGCTTTTATGGTTTTAGG + Intronic
940371018 2:152900899-152900921 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
940610933 2:155990821-155990843 TCTAGGAATTTTATAGCTTTAGG + Intergenic
940963032 2:159806586-159806608 ACCATGAGTTTTATGGGATTAGG + Intronic
941032273 2:160526132-160526154 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
941116249 2:161475844-161475866 TCTAGGGTTTTTATGGCTTTGGG - Intronic
941279548 2:163533125-163533147 GCCAGTACTTTGATGGCATTTGG - Intergenic
941409244 2:165132660-165132682 TCTAGGGTTTTTATGGCTTTAGG - Intronic
941550398 2:166908727-166908749 TCTAGGGTTTTTATGGCTTTAGG + Intronic
941845771 2:170130942-170130964 TCTAGGATTTTTATGGTTTTAGG - Intergenic
942760426 2:179390773-179390795 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
942828359 2:180208245-180208267 TCCAGGATTTTTATAGTTTTAGG + Intergenic
942845633 2:180421311-180421333 TCTAGGACTTTTATGGTCATAGG + Intergenic
942899226 2:181094247-181094269 TCTAGGATTTTTATGGTTTTAGG - Intergenic
943047361 2:182874534-182874556 TCTAGGATTTTTATGGTTTTAGG - Intergenic
943086930 2:183323390-183323412 TCTAGGATTTTTATGGCTTTAGG + Intergenic
943159623 2:184231064-184231086 TCTAGGATTTTTATGGTTTTAGG + Intergenic
943160649 2:184245632-184245654 TCTAGGATTTTTATGGTTTTAGG - Intergenic
943168413 2:184363377-184363399 TCCAGGGCAATTATGGCCTTTGG + Intergenic
943179251 2:184522848-184522870 TCTGAGACTTTTATGGCATTAGG + Intergenic
943205089 2:184884724-184884746 TCCAGGGTTTTTATGTCTTTAGG - Intronic
943307369 2:186280279-186280301 TCCAGGATTTTTATCACTTTGGG + Intergenic
943314570 2:186371158-186371180 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
943353809 2:186825685-186825707 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
943391341 2:187272806-187272828 TTTAGGAGTTTTATGGCTTTAGG + Intergenic
943504858 2:188742110-188742132 TCCAGGGTTTTTATGGTTTTAGG + Intronic
943660815 2:190557354-190557376 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
943871454 2:193006184-193006206 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
944021174 2:195106396-195106418 TCCAGGATTTGTATAGTATTAGG - Intergenic
944033457 2:195265110-195265132 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
944135331 2:196393176-196393198 TCTAGGGATTTTATGGCTTTAGG - Intronic
944358968 2:198828946-198828968 TCCAGGAATTTTATAGTTTTGGG - Intergenic
944620582 2:201510748-201510770 TCTAGTACTTTTATAGCATATGG - Intronic
944888677 2:204092955-204092977 TCCAGGAGTTTTATGGATTCAGG + Intergenic
944918168 2:204382535-204382557 TCCAGGGCTTTTATAGTTTTGGG + Intergenic
944924205 2:204446972-204446994 TCTAGGATTTTTATGGTTTTAGG + Intergenic
944928960 2:204496593-204496615 TGCAGGAATTTTATTTCATTTGG - Intergenic
944955292 2:204800823-204800845 TCTAGGATTTTTATGGTTTTAGG + Intronic
944955955 2:204809387-204809409 TCCAGGGTTTTTATAGCTTTTGG + Intronic
945315304 2:208364339-208364361 TCCAGAAGTTTTATTGCTTTGGG + Intronic
945334615 2:208578062-208578084 TCCAGGATTTTTATAGTTTTGGG + Intronic
945349908 2:208765164-208765186 TCTAGGATTTTTATGGTTTTAGG - Intronic
945516729 2:210771749-210771771 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
945553863 2:211255029-211255051 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
945812263 2:214563067-214563089 TCTAGGATTTTTATGGTTTTGGG + Intronic
946719511 2:222589392-222589414 TCTAGGATTTTTATGGTTTTAGG - Intronic
946789775 2:223288688-223288710 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
947018160 2:225644553-225644575 TCTAGGATTTTTATGGTTTTAGG + Intronic
947479657 2:230487282-230487304 TCCAGGGATTTTATGGCTTTGGG + Intronic
947492633 2:230608999-230609021 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
947494497 2:230624625-230624647 TCTAGGATTTTTATGGTGTTAGG - Intergenic
947497940 2:230652352-230652374 TCCTGGGCTTTTTTGGCATGGGG + Intergenic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
947902399 2:233732421-233732443 TCTAGGATTTTTATGGTTTTAGG + Intronic
948042834 2:234917394-234917416 ACCAGGATTTTAATGGCCTTAGG - Intergenic
948343560 2:237276158-237276180 TCCAGGGCTTTTATAGCTTTGGG - Intergenic
948480249 2:238245256-238245278 CCCAGCACTTTTAGGTCATTTGG - Exonic
1169796283 20:9466314-9466336 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1169817280 20:9670885-9670907 TCTAGGGTTTTTATGGTATTAGG + Intronic
1169970510 20:11265036-11265058 TTCAGGACTATTTTGACATTGGG + Intergenic
1170324092 20:15136591-15136613 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1170343273 20:15353382-15353404 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1170516905 20:17139461-17139483 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1170956136 20:20981185-20981207 TCCAGGAATTTTATTGTTTTAGG + Intergenic
1170993590 20:21329249-21329271 ACCAGGAATTTTAAGGCTTTGGG - Intronic
1171246745 20:23616463-23616485 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1171286984 20:23948334-23948356 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1171733608 20:28741356-28741378 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1171736262 20:28789423-28789445 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1171748659 20:29025714-29025736 TCTAGGTTTTTTATGGTATTAGG - Intergenic
1171786217 20:29467258-29467280 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1171820628 20:29834366-29834388 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1171822915 20:29871512-29871534 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1171897207 20:30818806-30818828 TCCAGGGCTTTTATAGTTTTGGG + Intergenic
1173761937 20:45569599-45569621 TTCAGGATTTTTATGGTTTTGGG + Intronic
1174116801 20:48231794-48231816 TCCAGCTCTTTTGTGGCACTTGG + Intergenic
1174876746 20:54234300-54234322 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1174941492 20:54933848-54933870 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1175011031 20:55736344-55736366 TCCAGGACTTTTATAGTTTTGGG + Intergenic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1176188959 20:63798108-63798130 TCTAGGATTTTTATGGTTTTAGG + Intronic
1176404098 21:6346147-6346169 TTTAGGTCTTTTATGACATTGGG + Intergenic
1176433059 21:6642957-6642979 TTTAGGTCTTTTATGACATTGGG - Intergenic
1176712306 21:10162354-10162376 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1176909017 21:14540171-14540193 TCTAGGATTTTTATGGTTTTAGG - Intronic
1176941596 21:14931978-14932000 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1177033765 21:16015842-16015864 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1177043551 21:16142647-16142669 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1177088422 21:16736000-16736022 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1177239424 21:18437354-18437376 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1177272806 21:18871188-18871210 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1177309948 21:19377041-19377063 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1177398586 21:20570896-20570918 TCCTGGTCTTTTATGGCCTCAGG - Intergenic
1177428605 21:20959600-20959622 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1177527326 21:22311535-22311557 TCAAGGACTTTTATGGATTTGGG - Intergenic
1177672880 21:24256371-24256393 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1177688803 21:24476526-24476548 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1177951375 21:27542232-27542254 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1178175456 21:30092842-30092864 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1178360306 21:31943899-31943921 TCCAGGACTCTGATGAAATTGGG + Intronic
1178784980 21:35645299-35645321 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1178903396 21:36615704-36615726 TCCAGGACTTAGATGGGGTTGGG - Intergenic
1179313458 21:40218110-40218132 TCCAGGGTTTTTATGGTTTTGGG + Intronic
1180020165 21:45118903-45118925 GCCAGGGCTTTTAGGGCATAAGG - Intronic
1180324657 22:11359315-11359337 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1180543828 22:16479846-16479868 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1181361004 22:22335781-22335803 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1181656143 22:24300995-24301017 TCTAGGATTTTTATGGTTTTGGG - Intronic
1182178189 22:28315236-28315258 TCAAAGACTTTTATGCCATTTGG + Intronic
1182758839 22:32705165-32705187 TCCAGGATTTTTATAGTTTTGGG + Intronic
1182974755 22:34612715-34612737 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1184908370 22:47508273-47508295 TCCAGAATTTTTATGGGTTTTGG - Intergenic
1185311397 22:50157443-50157465 TCCAAGAATTTTATGGATTTAGG + Intronic
949325216 3:2856087-2856109 TCCAGGAAACTTCTGGCATTTGG + Intronic
949423959 3:3896070-3896092 TCTAGGGCTTTTATGGTTTTAGG + Intronic
949453774 3:4216420-4216442 TCTAGGATTTTTATGGTTTTAGG - Intronic
949455948 3:4238886-4238908 TCCAGGGCTTTTATGGTTTTAGG + Intronic
949629856 3:5913122-5913144 TCTAGGATTTTTATGGTTTTAGG + Intergenic
949682888 3:6535978-6536000 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
949846554 3:8376908-8376930 TCTAGGACTTTTATGGTTTTAGG - Intergenic
950309833 3:11947600-11947622 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
950596746 3:13990821-13990843 TCTAGGGTTTTTATGGTATTAGG + Intronic
950940524 3:16885611-16885633 TCCAGGATTGGTCTGGCATTAGG + Intronic
951123664 3:18958917-18958939 TCTAGGATTTTTATGGTTTTAGG + Intergenic
951125678 3:18980955-18980977 TCTAGGATTTTTATGGTTTTAGG - Intergenic
951233394 3:20206404-20206426 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
951238874 3:20266956-20266978 TCTAGGATTTTTATGGTTTTAGG + Intergenic
951315416 3:21184303-21184325 TCAAGGAGTTTTATGGTTTTAGG - Intergenic
951331041 3:21367991-21368013 TCTAGGATTTTTATGGTTTTAGG - Intergenic
951442452 3:22738849-22738871 TCTAGGATTTTTATGGTTTTAGG + Intergenic
951474261 3:23088420-23088442 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
951479443 3:23143907-23143929 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
951515486 3:23554604-23554626 TCGAGGAGTTTTATGGCTTCAGG - Intronic
951983965 3:28597425-28597447 TTCAGGACCTCTATGGCATCAGG + Intergenic
952004845 3:28831601-28831623 TCCAGGATTTTTATAGTTTTGGG - Intergenic
952987853 3:38802678-38802700 TCTAGGATTTTTATGGTTTTAGG - Intergenic
953001449 3:38937251-38937273 TCTAGGATTTTTATGGTTTTAGG - Intronic
953105378 3:39873450-39873472 TCTAGGATTTTTATGGTTTTAGG + Intronic
953153480 3:40346443-40346465 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
953191010 3:40688187-40688209 TCCAGGACTATCCTGGCTTTAGG + Intergenic
953264732 3:41375659-41375681 TCCAGGGTTTTTATGGGTTTAGG - Intronic
953287106 3:41621643-41621665 TCTAGGATTTTTATGGTTTTGGG - Intronic
953523341 3:43664410-43664432 TCTAGGATTTTTATGGCCCTAGG - Intronic
953539337 3:43801994-43802016 TCTAGGATTTTTATGGTTTTAGG + Intergenic
953555300 3:43941124-43941146 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
954017646 3:47708572-47708594 TCCAAGGCTTTTTTGTCATTAGG - Intronic
954416412 3:50395578-50395600 TCCAGGCCTGATATGGCATGTGG + Intronic
954513386 3:51148454-51148476 TCTAGGATTTTTATGGTTTTAGG + Intronic
955262964 3:57412786-57412808 TCCACGTCTTCTCTGGCATTTGG - Intronic
955464456 3:59221950-59221972 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
955622654 3:60881327-60881349 TCCCCAACTATTATGGCATTGGG - Intronic
955822991 3:62916064-62916086 TCCAGGGCTTTTATGGTTTTAGG + Intergenic
956032903 3:65058751-65058773 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
956034532 3:65076246-65076268 TCCAGGGTTTTTATGGCGTTAGG + Intergenic
956051575 3:65253888-65253910 TCTAGGATTTTTATGGTTTTAGG + Intergenic
956344279 3:68260799-68260821 TCTAGGATTTTTATGGTTTTAGG - Intronic
956393972 3:68804832-68804854 TCCAGGGTTTTTATGGTTTTAGG - Intronic
956512323 3:70007758-70007780 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
956584248 3:70847346-70847368 TCTAGGATTTTTATGGTTTTAGG + Intergenic
956847249 3:73194908-73194930 TCTAGGATTTTTATGGTTTTAGG + Intergenic
957097990 3:75795006-75795028 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
957466403 3:80598607-80598629 TCTAGGATTTTTATGGTTTTAGG - Intergenic
957534791 3:81487653-81487675 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
957584618 3:82117815-82117837 TCTAGGATTTTTATGGTACTAGG - Intergenic
957598482 3:82300591-82300613 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
957629625 3:82702525-82702547 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
957683921 3:83475343-83475365 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
957688529 3:83537100-83537122 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
957867549 3:86044090-86044112 TCTAGGATTTTTATGGTTTTAGG - Intronic
957871749 3:86097969-86097991 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
957887141 3:86302047-86302069 TCTAGGATTTTTATGGTTTTAGG - Intergenic
957948384 3:87093357-87093379 TCTAGGATTTTTATGGTTTTAGG + Intergenic
958013592 3:87912968-87912990 TCCAGGACTTTTATAGTTTTGGG - Intergenic
958044019 3:88261023-88261045 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
958136588 3:89502336-89502358 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
958257006 3:91336557-91336579 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
958262138 3:91394203-91394225 TCTAGGATTTTTATGGTTTTAGG - Intergenic
958405217 3:93748932-93748954 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
958433853 3:94073911-94073933 TCTAGGATTTTTATGGTTTTAGG + Intronic
958467590 3:94476805-94476827 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
958654185 3:96980163-96980185 TCTAGGGTTTTTATGGCTTTAGG + Intronic
958669505 3:97185094-97185116 TCTAGGGTTTTTATGGCTTTAGG - Intronic
958976333 3:100671667-100671689 TCTAGGATTTTTATGGTTTTAGG + Intronic
959259046 3:104051568-104051590 TCTAGGATTTTTATGGCTTTGGG - Intergenic
959271883 3:104221857-104221879 TCTAGGATTTTTATGGTTTTAGG + Intergenic
959453150 3:106527778-106527800 TCAAGGATTTTTATGGTTTTAGG - Intergenic
959482722 3:106893031-106893053 TCCAGGATTTTTATGGTTTTTGG - Intergenic
959510394 3:107204196-107204218 TCCAGGGCTTTTATAGTTTTAGG - Intergenic
959735441 3:109652935-109652957 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
959848534 3:111061693-111061715 TCGAGGATTTTTATGGTTTTAGG - Intergenic
960212655 3:114989213-114989235 TCTAGGATTTTTATGGTTTTAGG + Intronic
960238518 3:115313418-115313440 TCTAGGGTTTTTATGGTATTAGG + Intergenic
960278039 3:115749410-115749432 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
960278639 3:115755910-115755932 TACAGGGTTTTTATGGCTTTAGG - Intergenic
960314439 3:116159135-116159157 TCAAGGATTTTTATAGCTTTAGG - Intronic
960401870 3:117209972-117209994 TCTAGGTCTTTTATGGTTTTAGG - Intergenic
960414160 3:117363721-117363743 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
960500460 3:118431479-118431501 TCCAGGATTTTTATAGTTTTAGG + Intergenic
960686102 3:120295479-120295501 TCCAGGACTTTTATAGTTTTGGG - Intergenic
960783984 3:121351795-121351817 TCTAGGGCTTTTATGGTTTTAGG + Intronic
961354325 3:126325922-126325944 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
961997769 3:131264324-131264346 TCTAGGATTTTTATGGTTTTAGG + Intronic
962001290 3:131300491-131300513 TCCAGGATTTTTATTGTTTTAGG + Intronic
962101007 3:132342592-132342614 GCCAGGACCTTTTTGGAATTTGG + Exonic
962456231 3:135568018-135568040 TCCAGGTATATTATGGCACTGGG - Intergenic
962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG + Intronic
962683987 3:137828674-137828696 TCTAGGATTTTTATGGTTTTAGG - Intergenic
962692762 3:137917003-137917025 TCTAGGATTTTTATGGTTTTAGG + Intergenic
962692772 3:137917094-137917116 TCTAGGATTTTTATGGTTTTAGG + Intergenic
962707192 3:138055444-138055466 TCCAAGAGTTTTATAGCTTTAGG - Intergenic
963053868 3:141167163-141167185 TCCAGAAATTTTATAGCTTTAGG + Intergenic
963057566 3:141199476-141199498 TCCAGGATTTTTATAGTTTTGGG - Intergenic
963340455 3:144026355-144026377 TCTAGGATTTTTATGGTTTTAGG - Intronic
963450852 3:145480355-145480377 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
963579844 3:147111622-147111644 TCCAGGATTTTTATAGTTTTGGG + Intergenic
963632260 3:147747824-147747846 TCCAGGGCTTTTATAGATTTGGG + Intergenic
963927239 3:150963943-150963965 TCTAGGATTTTTATGGTTTTAGG - Intronic
963977442 3:151497287-151497309 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
963983988 3:151570846-151570868 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
964126287 3:153236870-153236892 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
964134110 3:153325159-153325181 TCCAGGATTTTTATGGTTTTAGG + Intergenic
964550982 3:157884369-157884391 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
964783208 3:160363887-160363909 TCTAGGATTTTTATGGTTTTAGG - Intronic
964842659 3:161011128-161011150 TCTAGGGTTTTTATGGCTTTAGG + Intronic
964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG + Intergenic
964992590 3:162832742-162832764 TCTAGGGGTTTTATGGCTTTGGG - Intergenic
965190048 3:165516326-165516348 TCTAGGATTTTTATGGTTTTAGG + Intergenic
965211319 3:165793139-165793161 TCTAGTAATTTTATGGCTTTAGG + Intronic
965292744 3:166904854-166904876 TCCAGGGATTTTATGGCTTTAGG + Intergenic
965366386 3:167805651-167805673 TCTAGGATTTTTATGGTTTTAGG + Intronic
965383263 3:168015920-168015942 TCCAGGGTTTTTATGGTTTTAGG - Intronic
965393487 3:168133324-168133346 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
965480185 3:169209234-169209256 TCTAGGATTTTTATGGTTTTGGG - Intronic
965885952 3:173447176-173447198 TCTAGGATTTTTATGGTTTTAGG + Intronic
966070488 3:175871451-175871473 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
966073554 3:175908046-175908068 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
966134016 3:176677848-176677870 TCTAGGATTTTTATGGTTTTGGG - Intergenic
966280461 3:178220598-178220620 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
966352253 3:179043602-179043624 TCTAGGATTTTTATGGTTTTAGG - Intronic
967198857 3:187053410-187053432 TCCAGGGTTTTTATGGTTTTAGG + Intronic
967376543 3:188809792-188809814 TCTAGGGCTTTTATGGTTTTGGG + Intronic
967392060 3:188966175-188966197 TCTAGGATTTTTATGGTTTTGGG + Intronic
967445427 3:189560175-189560197 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
967508223 3:190278492-190278514 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
967796847 3:193607378-193607400 TCTAGGATTTTTATGGTTTTAGG + Intronic
968358764 3:198131284-198131306 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
968692685 4:2002762-2002784 TCTAGGATTTTTATGGTTTTGGG - Intronic
968828544 4:2917642-2917664 TCTAGGATTTTTATGGTTTTAGG + Intronic
969142436 4:5090322-5090344 TCCAGGGCTTTAATGGTTTTGGG + Intronic
969352569 4:6606262-6606284 TCCAGGACTTCTCTGGGAATGGG + Intronic
969993652 4:11290083-11290105 TCCAGAACTTTAATGGAAATAGG + Intergenic
970012665 4:11477000-11477022 TCCAGGATTTTTATAGTTTTGGG - Intergenic
970027945 4:11643665-11643687 TCTAGGATTTTTATGGTTTTAGG + Intergenic
970079553 4:12265115-12265137 TCTAGGATTTTTATGGTTTTAGG + Intergenic
970196132 4:13551632-13551654 TCCAGGACTTTTGTAGTTTTGGG - Intergenic
970543119 4:17099205-17099227 TATAGAACTGTTATGGCATTTGG + Intergenic
970688772 4:18598239-18598261 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
970815062 4:20145412-20145434 TCTAGGATTTTTATGGTTTTAGG - Intergenic
971211229 4:24618681-24618703 TCCAGGAGTTTTATGGCTTCAGG + Intergenic
971583329 4:28371827-28371849 TCCAGGATTTTTATTGTTTTAGG - Intronic
971590732 4:28466108-28466130 TCTAGGAGTTTTAGGGCATCGGG - Intergenic
971671380 4:29562273-29562295 TCTAGGGTTTTTATGGTATTAGG + Intergenic
971706338 4:30048265-30048287 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
971723155 4:30273207-30273229 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
971980920 4:33748652-33748674 TACAGGACTTTAAATGCATTAGG + Intergenic
972101118 4:35418366-35418388 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
972140596 4:35954548-35954570 TCCAGCACTTTTATTGAATAGGG + Intronic
972262091 4:37419279-37419301 TCCAGGACTTTTATGGTCCTAGG - Intronic
972764299 4:42137395-42137417 TCCAGGACTTTTATAGTTTCTGG - Intronic
972825570 4:42755239-42755261 TCTAGGATTTTTATGGTTTTGGG + Intergenic
972877182 4:43376938-43376960 TCTAGGATTTTTATGGTCTTGGG - Intergenic
972928197 4:44038847-44038869 TCCTGGAATTTTCTGGAATTTGG + Intergenic
972929265 4:44051153-44051175 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
972955658 4:44387746-44387768 TCCAGGATTTTTATAGTTTTGGG - Intronic
972964889 4:44497511-44497533 TCTAGGGCTTTTATGGTATTAGG + Intergenic
972972815 4:44598098-44598120 TCTAGGATTTTTATGGTTTTAGG - Intergenic
972973209 4:44602833-44602855 TCTAGGATTTTTATGGTTTTAGG + Intergenic
973018260 4:45168287-45168309 TCTAGGGTTTTTATGGCTTTGGG + Intergenic
973081424 4:45998427-45998449 TCTAGGATTTTTATGGTTTTAGG + Intergenic
973132344 4:46663265-46663287 TCTAGGACTTTTATGGTTTTAGG + Intergenic
973328269 4:48886037-48886059 TCTAGGATTTTTATGGTTTTAGG + Intronic
973564089 4:52166323-52166345 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
973568274 4:52210619-52210641 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
973596851 4:52500501-52500523 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
973721482 4:53728563-53728585 TCCAGGGTTTTTATGGTTTTAGG - Intronic
973729299 4:53808213-53808235 TCTAGGACTTTTATGATATCAGG + Intronic
974152208 4:58024389-58024411 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
974236384 4:59186763-59186785 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
974303876 4:60106080-60106102 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
974315179 4:60270139-60270161 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
974315726 4:60278185-60278207 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
974371574 4:61023030-61023052 TCTAGGATTTTTATGGTTTTAGG - Intergenic
974491173 4:62567042-62567064 TCTAGGATTTTTATGGTTTTAGG + Intergenic
974535164 4:63165159-63165181 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
974543292 4:63267195-63267217 TCTAGGATTTTTATGGTTTTAGG - Intergenic
974643874 4:64668567-64668589 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
974768517 4:66380325-66380347 TCTAGGGTTTTTATGGTATTGGG - Intergenic
974769101 4:66387606-66387628 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
974772518 4:66434250-66434272 TCCAGGCCTTTGATGGGAGTGGG + Intergenic
974826092 4:67132823-67132845 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
974830424 4:67181928-67181950 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
974926624 4:68306936-68306958 TCTAGGAGTTTTATGGCTTCAGG + Intergenic
974947088 4:68541756-68541778 TCCAGGGTTTTTATGGTTTTGGG + Intronic
974968398 4:68794315-68794337 TCTATGACTTTTATGGTTTTGGG + Intergenic
975032695 4:69641506-69641528 TCCAGGCTTTTTTTGGCCTTGGG - Intronic
975111549 4:70634198-70634220 TCCAGGACTTTTAAGCTCTTTGG + Intronic
975162881 4:71144058-71144080 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
975166143 4:71180230-71180252 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
975199876 4:71574487-71574509 TCTAGGATTTTTATGGTTTTAGG + Intergenic
975239870 4:72044311-72044333 TCCAGGATTTTTATAGTTTTAGG + Intronic
975354912 4:73390665-73390687 TCTAGGAATTTTATGGTTTTAGG + Intergenic
975449727 4:74510355-74510377 TCTAGGATTTTTATGGTGTTAGG - Intergenic
975474673 4:74809732-74809754 TCTAGGATTTTTATGGTTTTAGG - Intergenic
975501098 4:75085832-75085854 TCTAGGATTTTTATGGTTTTAGG + Intergenic
975501930 4:75096115-75096137 TCTAGGATTTTTATGGTCTTAGG + Intergenic
975520588 4:75296761-75296783 TCCAGGTTTTTTATGGTTTTAGG + Intergenic
975522888 4:75319182-75319204 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
975531691 4:75406091-75406113 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
975535277 4:75443646-75443668 TCTAGGATTTTTATGGTTTTAGG + Intergenic
975670596 4:76776710-76776732 TCTAGAATTTTTATGGCTTTAGG + Intronic
975724789 4:77281406-77281428 TCTAGGATTTTTAGGGTATTGGG + Intronic
975726476 4:77296602-77296624 TCTAGGGCTTTTATGGTTTTAGG + Intronic
975744190 4:77459710-77459732 TCTAGGATTTTTATGGTTTTAGG + Intergenic
975750196 4:77514918-77514940 TCTAGGATTTTTATGGTTTTAGG + Intronic
975821189 4:78272423-78272445 TCTAGGATTTTTATGGTTTTAGG + Intronic
975842723 4:78492675-78492697 TCTAGGATTTTTATGGTTTTAGG - Intronic
975904349 4:79191793-79191815 TCCAGGATTTTTATAGTTTTGGG + Intergenic
975930657 4:79518348-79518370 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
975952768 4:79794045-79794067 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
976024505 4:80671101-80671123 TCTAGGGTTTTTATGGCTTTAGG + Intronic
976115308 4:81720226-81720248 TCCAGGGTTTTTATGGTGTTAGG - Intronic
976159191 4:82180421-82180443 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
976392926 4:84524371-84524393 TCTAGGATTTTTATGGTTTTAGG - Intergenic
976580082 4:86725930-86725952 TCTAGGATTTTTATGGCTTTAGG + Intronic
976761191 4:88551164-88551186 TCCAGGGTTTTTATGGTTTTAGG - Intronic
976910830 4:90303680-90303702 TCTAGGGTTTTTATGGTATTAGG - Intronic
976930812 4:90564636-90564658 TCCAGTAGTTTTATGGCTTCAGG + Intronic
977003992 4:91542340-91542362 TCCAGGGTTTTTATGGTTTTAGG + Intronic
977184833 4:93923973-93923995 TCTAGGATTTTTATGGGGTTAGG - Intergenic
977385777 4:96337479-96337501 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
977404361 4:96577004-96577026 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
977469573 4:97425824-97425846 TCCAGGGTTTTTATGGTTTTAGG + Intronic
977477135 4:97526787-97526809 TCCAGGGTTTTTATGGTTTTAGG + Intronic
977679057 4:99779028-99779050 TCTAGGGCTTTTATAGCTTTGGG - Intergenic
977699126 4:100001638-100001660 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
978012254 4:103701929-103701951 TCTAGGATTTTTATGGTTTTAGG - Intronic
978069877 4:104454051-104454073 TCCAGTTCTTTTTTGGCATCTGG + Intergenic
978078467 4:104563279-104563301 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
978270539 4:106884395-106884417 TCCAGGGTTTTTATGGTGTTAGG - Intergenic
978320158 4:107484498-107484520 TCTAGGATTTTTATGGTTTTAGG - Intergenic
978418849 4:108508113-108508135 TCTAGGATTTTTATGGTTTTAGG - Intergenic
978508299 4:109484943-109484965 TCCTGAGTTTTTATGGCATTTGG + Intronic
978600454 4:110421819-110421841 TCTAGGGCTTTTATGGTTTTAGG - Intronic
978680068 4:111369418-111369440 TCTAGGATTTTTATGGTTTTAGG - Intergenic
978845393 4:113267361-113267383 TCTAGGATTTTTATGGCTTTAGG + Intronic
979191022 4:117858783-117858805 TCCAGGATTTTTATAGTTTTGGG - Intergenic
979301202 4:119089490-119089512 TCCAGGGTTTTTATAGTATTAGG + Intergenic
979401196 4:120251848-120251870 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
979417318 4:120459771-120459793 TCGATGACTTCTATGGCTTTTGG - Intergenic
979423174 4:120531493-120531515 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
979512693 4:121572333-121572355 TCTAGGATTTTTATGGTTTTGGG - Intergenic
979554520 4:122029787-122029809 TCTAGGATTTTTATGGTTTTAGG + Intergenic
979565381 4:122148847-122148869 TCCAGGATTTTTATAGTTTTAGG - Intergenic
979686171 4:123512365-123512387 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
979689366 4:123544141-123544163 TTAAGGACTTGTATGGGATTTGG + Intergenic
979978583 4:127226621-127226643 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
979984879 4:127301412-127301434 TCCAGAATTTTTATGGTTTTAGG - Intergenic
979998251 4:127459232-127459254 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
980000150 4:127477692-127477714 TCTAGGATTTTTATGGTTTTAGG - Intergenic
980060153 4:128119765-128119787 TCAAAGACTTTTATGACTTTCGG - Intronic
980099866 4:128530995-128531017 TCTAGGATTTTTATGGTTTTTGG + Intergenic
980117547 4:128693901-128693923 TCTAGGAATTTTATAGCTTTTGG - Intergenic
980183765 4:129435258-129435280 TCTAGGATTTTTATGGTTTTAGG - Intergenic
980205653 4:129716600-129716622 TCTAGGATTTTTATGGTTTTAGG + Intergenic
980276308 4:130655408-130655430 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
980593576 4:134924130-134924152 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
980630336 4:135423178-135423200 TCTAGGATTTTTATGGTTTTAGG - Intergenic
980705357 4:136485850-136485872 CCCAGGACTTATGTGGCATATGG + Intergenic
980810169 4:137867511-137867533 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
980870523 4:138606632-138606654 TCTAGGAATTTTATGGTTTTAGG - Intergenic
980926902 4:139146905-139146927 TCTAGGACTTTTATGGTTTTAGG - Intronic
981069574 4:140520904-140520926 TCTAGGATTTTTATGGTTTTAGG - Intergenic
981133473 4:141184614-141184636 TCTAGGGTTTTTATGGCTTTAGG + Intronic
981200123 4:141970717-141970739 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
981203012 4:142004965-142004987 CCCAGGACTTTTATAGCTTTGGG + Intergenic
981255210 4:142653252-142653274 TCTAGGGTTTTTATGGCTTTAGG - Intronic
981272588 4:142861849-142861871 TCTAGGATTTTTATGGTTTTAGG - Intergenic
981346035 4:143677422-143677444 TCTAGGGTTTTTATGGCTTTTGG - Intronic
981357292 4:143804319-143804341 TCTAGGATTTTTATGGGTTTAGG - Intergenic
981443852 4:144812045-144812067 TCTAGGGTTTTTATGGTATTAGG - Intergenic
981556314 4:145998865-145998887 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
981619610 4:146679507-146679529 TCCAGGGTTTTTATGGTGTTAGG - Intergenic
981684582 4:147439050-147439072 TCTAGGATTTTTATGGTTTTAGG - Intergenic
981687115 4:147467038-147467060 TCCAGGATTTTTATGGTTTTAGG + Intergenic
981850448 4:149223448-149223470 TCCAGGATTTTTATAGTTTTGGG - Intergenic
981881497 4:149618381-149618403 TCTAGGATTTTTATGGCTTCAGG - Intergenic
981905800 4:149920422-149920444 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
982324336 4:154113870-154113892 TCTAGGATTTTTATGGTTTTAGG - Intergenic
982352032 4:154426177-154426199 TCAAGGACTTTGGTGGCAATAGG - Intronic
982564079 4:156967399-156967421 TCAAGGGCTTTTGTGGCATGTGG - Intronic
982601426 4:157455562-157455584 TCTAGGATTTTTATGGTTTTAGG + Intergenic
982625025 4:157755931-157755953 TCCAGGATTTTTATGGTCCTAGG + Intergenic
982681434 4:158435648-158435670 TCTAGGATTTTTATGGTTTTAGG - Intronic
982690785 4:158545561-158545583 TCTAGGGCTTTTATGGTTTTAGG + Intronic
982792596 4:159610528-159610550 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
982906765 4:161084470-161084492 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
983134617 4:164065320-164065342 TCCAGGATTTTTATAGTTTTGGG - Intronic
983179897 4:164635527-164635549 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
983290189 4:165792890-165792912 TCCAGGACTTTCATAGCTATAGG - Intergenic
983362848 4:166748515-166748537 TCTAGGGTTTTTATGGCTTTAGG - Intronic
983393235 4:167160923-167160945 TCTAGGATTTTTATGGTTTTAGG - Intronic
983546668 4:168971899-168971921 TCTAGAACTTTTATGGTTTTGGG + Intronic
983958438 4:173723915-173723937 TCTAGGATTTTTATGGTATTAGG + Intergenic
984077632 4:175203400-175203422 TCCAGAAGTTCTATTGCATTTGG + Intergenic
984335476 4:178383968-178383990 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
984433604 4:179680764-179680786 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
984516758 4:180750848-180750870 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
984593555 4:181642582-181642604 TCTAGGATTTTTATGGTTTTAGG + Intergenic
984695971 4:182780167-182780189 TCTAGGGCTTTTATGGTTTTAGG + Intronic
985204984 4:187525763-187525785 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
985332901 4:188860062-188860084 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
985443701 4:190006331-190006353 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
985462127 4:190117592-190117614 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
986195010 5:5530203-5530225 TCCAGGGCTTTTATGGTTTTAGG + Intergenic
986461176 5:7973857-7973879 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
986804452 5:11295862-11295884 TCTAGGGTTTTTATGGCTTTAGG - Intronic
986822200 5:11480120-11480142 TCCAGGATTTTTATAGCTTGGGG + Intronic
986953763 5:13124813-13124835 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
987531058 5:19119891-19119913 TCCAGGATTTTTATAGTTTTGGG - Intergenic
987809965 5:22822261-22822283 TCTAGGATTTTTATGGTTTTAGG - Intronic
987817336 5:22919663-22919685 TCTAGGATTTTTATGGTTTTGGG - Intergenic
988003502 5:25379643-25379665 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
988022231 5:25635790-25635812 TCCAGGATTTTTATGGTTTTTGG + Intergenic
988216057 5:28274445-28274467 TCTGGGATTTTTATGGCTTTAGG + Intergenic
988235364 5:28536806-28536828 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
988323647 5:29733971-29733993 TCCAGGATTTTTATAGTTTTGGG - Intergenic
988390486 5:30622076-30622098 TCTAGGATTTTTATGGTTTTAGG + Intergenic
988402557 5:30780419-30780441 TCTAGGGCTTTTATGGCTTTAGG - Intergenic
988618684 5:32800194-32800216 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
988672185 5:33393733-33393755 TCCAGGATTTTTATGGTTTTAGG - Intergenic
988794675 5:34641794-34641816 TCTAGGATTTTTATGGTTTTAGG + Intergenic
988887837 5:35578252-35578274 TCCAGAACATATATGTCATTAGG - Intergenic
988894937 5:35662539-35662561 TCCAGGGTTTTTATAGCTTTGGG + Intronic
989207029 5:38819997-38820019 TCCAGGATTTTTATAGTATCAGG - Intergenic
989244584 5:39240202-39240224 TCCAGGGTTTTTATGGTTTTAGG - Intronic
989248121 5:39276849-39276871 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
989407156 5:41074388-41074410 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
989627078 5:43439975-43439997 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
989803986 5:45581632-45581654 TCTAGGGTTTTTATGGTATTAGG + Intronic
989848069 5:46171433-46171455 TCTAGGGCTTTTATGGCTTTAGG - Intergenic
989959346 5:50392001-50392023 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
990036838 5:51331893-51331915 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
990084430 5:51956807-51956829 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
990107324 5:52280432-52280454 TCTAGGATTTTTATGGTTTTAGG - Intergenic
990111901 5:52336731-52336753 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
990240035 5:53807790-53807812 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
990242444 5:53829064-53829086 CCCAGAACTGATATGGCATTTGG + Intergenic
990691822 5:58372691-58372713 TCCAGGGCTTTTATGGTTTTAGG + Intergenic
990839578 5:60061945-60061967 TCCAGGGTTTTTATGGTTTTGGG - Intronic
990882970 5:60560499-60560521 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
990883973 5:60571067-60571089 TCTAGGATTTTTATGGTTTTAGG + Intergenic
991046311 5:62226452-62226474 TCCAGGTTTTTTATGGTTTTAGG + Intergenic
991110283 5:62891989-62892011 TCTAGGGTTTTTATGGTATTAGG + Intergenic
991115634 5:62951416-62951438 TCTAGGACTTTTATGGTTTTAGG + Intergenic
991189085 5:63847753-63847775 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
991232418 5:64350520-64350542 TCTAGGGTTTTTATGGCTTTAGG + Intronic
991233350 5:64363206-64363228 TCCAGGGTTTTTATGGTTTTGGG + Intronic
991571994 5:68064719-68064741 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
992032169 5:72732617-72732639 TCTAGGGTTTTTATGGCTTTTGG - Intergenic
992313948 5:75533196-75533218 TCCAGGGTTTTTATGGTTTTAGG + Intronic
992353513 5:75955424-75955446 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
992403519 5:76433295-76433317 TCTAGAACTTTTATGGTTTTAGG + Intronic
992824149 5:80531266-80531288 TCTAGGGTTTTTATGGCTTTAGG - Intronic
992881001 5:81109803-81109825 ACCAGGACTTTTCTGCCTTTGGG + Intronic
992909168 5:81378365-81378387 TCTAGGATTTTTATGGTTTTAGG - Intronic
993012861 5:82503699-82503721 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
993171790 5:84429474-84429496 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
993512961 5:88794753-88794775 TCCAGGGTTTTTATGGTTTTAGG + Intronic
993674420 5:90799957-90799979 TCTAGGATTTTTATGGTTTTGGG - Intronic
993742705 5:91560402-91560424 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
993797164 5:92282030-92282052 TCTAGGATTTTTATGGTTTTAGG - Intergenic
993884857 5:93404009-93404031 TCCGGGACACTTATGGCAGTTGG + Intergenic
994004618 5:94823160-94823182 TCCAGGGTTTTTATGGTTTTAGG + Intronic
994199686 5:96958696-96958718 TCCTGCACTTTTTTGGCTTTTGG + Intronic
994300343 5:98139843-98139865 TCTAGGATTTTTATGGTTTTAGG - Intergenic
994307529 5:98224757-98224779 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
994315283 5:98326006-98326028 TCTAGGATTTTTATGGTTTTGGG - Intergenic
994387669 5:99151235-99151257 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
994479068 5:100310172-100310194 TCTAGGATTTTTATGGTTTTAGG - Intergenic
994651351 5:102533410-102533432 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
994808520 5:104481730-104481752 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
994846944 5:105001675-105001697 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
994887724 5:105586361-105586383 TCTAGAACTTTTATGGTTTTAGG - Intergenic
994953773 5:106499911-106499933 TCTAGAATTTTTATGGCTTTAGG + Intergenic
994957456 5:106551607-106551629 TCCAGGATTTTTATAGTTTTGGG - Intergenic
995001260 5:107132953-107132975 TCCAGGAATTTTATGGTTTGGGG + Intergenic
995416457 5:111918740-111918762 TCTAGGGCTTTTATGGTTTTAGG - Intronic
995426320 5:112027460-112027482 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
995475489 5:112543985-112544007 TCTAGGATTTTTATGGTTTTAGG - Intergenic
995630986 5:114132242-114132264 TCTAGGGCTTTTATGGTTTTGGG + Intergenic
995643171 5:114280412-114280434 TCTAGGATTTTTATGGTTTTAGG + Intergenic
995755622 5:115500770-115500792 TCCAGGAGTTTTATAGTTTTGGG + Intergenic
996245484 5:121258792-121258814 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
996761475 5:126990426-126990448 TCTAGGGCTTTTATGGTTTTAGG - Intronic
996854495 5:127989877-127989899 TCTAGGATTTTTATGGTTTTGGG + Intergenic
996902237 5:128555649-128555671 TCTAGGATTTTTATGGTTTTAGG - Intronic
997004033 5:129797805-129797827 TCTAGGATTTTTATGGTTTTAGG + Intergenic
997027936 5:130088247-130088269 TCCAGGGTTTTTATGGTTTTAGG - Intronic
997077998 5:130703956-130703978 TCTAGGATTTTTATGGTTTTAGG - Intergenic
997097888 5:130934081-130934103 TCTAGGATTTTTATGGTTTTGGG - Intergenic
997185312 5:131876024-131876046 TCTAGGGTTTTTATGGCTTTAGG - Intronic
997186687 5:131888822-131888844 TCTAGGGTTTTTATGGCTTTAGG + Intronic
997790214 5:136752444-136752466 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
998427639 5:142042541-142042563 TCTAGGATTTTTATGGTTTTAGG + Intergenic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
998732633 5:145097752-145097774 TCTAGGATTTTTATGACTTTAGG + Intergenic
998776141 5:145605284-145605306 TCCAGGGTTTTTATAGCTTTAGG + Intronic
998779689 5:145642627-145642649 TCTAGGATTTTTATGGTTTTAGG + Intronic
998961850 5:147496278-147496300 TCTAGGGCTTTTATGGTTTTAGG - Intronic
999489381 5:152034416-152034438 TCTAGGATTTTTATGGTTTTAGG + Intergenic
999552769 5:152707305-152707327 TGCAGGGCTTTTATGGTTTTGGG + Intergenic
999797134 5:154999341-154999363 TCTAGGAATTTTATGGTTTTAGG + Intergenic
1000271229 5:159685198-159685220 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1000376466 5:160587062-160587084 TCTAGGGCTTTTATGGTTTTGGG + Intronic
1000557791 5:162748265-162748287 AACAGGACTTTTATAGCCTTGGG - Intergenic
1000797901 5:165688535-165688557 TCTAGGGTTTTTATGGCATTAGG + Intergenic
1000868705 5:166548018-166548040 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1001343804 5:170871632-170871654 TCTAGAGCTTTTATGGCTTTGGG + Intronic
1002975977 6:2076790-2076812 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1002997620 6:2301871-2301893 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1003230415 6:4246793-4246815 CCTAGGAGTTTTATGGTATTGGG + Intergenic
1003249210 6:4410764-4410786 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
1003710609 6:8585388-8585410 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1003818832 6:9872298-9872320 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1003855088 6:10265352-10265374 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1004766302 6:18731570-18731592 TCTAGGACTTTTATAGTTTTAGG - Intergenic
1004805392 6:19198725-19198747 TCCAGGATTTTTATAGCTGTGGG + Intergenic
1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG + Intergenic
1005177533 6:23063845-23063867 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1005239633 6:23808939-23808961 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1005240559 6:23820492-23820514 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1006203382 6:32317337-32317359 TCCAGGGTTTTTATAGCTTTGGG - Intronic
1007347744 6:41245940-41245962 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1007869496 6:45017457-45017479 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1007882267 6:45180747-45180769 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1007945532 6:45823509-45823531 TCCAGGAGTTTAGTAGCATTAGG - Intergenic
1008003532 6:46385900-46385922 TCTAGGATTTTTATGGTTTTGGG - Intronic
1008083339 6:47217778-47217800 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1008186318 6:48395446-48395468 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1008297162 6:49792597-49792619 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1008324626 6:50162660-50162682 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1008335146 6:50294744-50294766 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1008642736 6:53481338-53481360 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1008775921 6:55037503-55037525 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1008782091 6:55119882-55119904 TCTAGGATTTTTATGGTTTTAGG + Intronic
1008817849 6:55590430-55590452 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1008884856 6:56421755-56421777 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1008896571 6:56563691-56563713 TCTAGGATTTTTATGGTTTTAGG + Intronic
1009054764 6:58321428-58321450 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1009175604 6:60456452-60456474 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1009236381 6:61129147-61129169 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1009272995 6:61638536-61638558 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1009291873 6:61892781-61892803 TCTAGGGTTTTTATGGTATTAGG - Intronic
1009304506 6:62071452-62071474 TCTAGGATTTTTATGGTTTTAGG + Intronic
1009355451 6:62739365-62739387 TCCAGGGCTTTTATGGTTTTAGG + Intergenic
1009378678 6:63003333-63003355 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1009380960 6:63029170-63029192 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1009389194 6:63125493-63125515 TCTAGGACTGTTAAGGCATTTGG + Intergenic
1009506323 6:64484853-64484875 TCAAGGACATTTACGGAATTAGG + Intronic
1009512761 6:64573303-64573325 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1009597339 6:65752609-65752631 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1009776580 6:68213149-68213171 GCCAGGGCTTTTCTGGGATTCGG - Intergenic
1009802123 6:68552020-68552042 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1009812580 6:68688224-68688246 TTCAGCACTTTTGTGGCAGTGGG - Intronic
1009950044 6:70384959-70384981 TCTAGGAGTTTTATGGTTTTAGG + Intergenic
1009984493 6:70766858-70766880 TCCAGGGCTTTTATGGTTTTAGG + Intronic
1009986502 6:70787328-70787350 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1010138347 6:72582296-72582318 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1010297606 6:74218428-74218450 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1010397782 6:75411529-75411551 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1010459906 6:76102415-76102437 TCTAGGGCTTTTATGGCTTTAGG - Intergenic
1010526001 6:76901321-76901343 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1010589383 6:77695375-77695397 TCTAGGGTTTTTATGGTATTAGG + Intronic
1010598891 6:77799605-77799627 TCTAGGATTTTTATGGTTTTAGG + Intronic
1010615588 6:78008120-78008142 TCCTGGAGTTTTGTGGTATTAGG + Intergenic
1010658743 6:78544060-78544082 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1010728613 6:79364002-79364024 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1010836812 6:80598448-80598470 TCCAGGGTTTTTATGGTTTTGGG - Intergenic
1010852604 6:80796333-80796355 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1010942181 6:81931844-81931866 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1010956127 6:82092821-82092843 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1010959134 6:82125293-82125315 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1011006390 6:82650360-82650382 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1011063670 6:83300265-83300287 TCCAGGGTTTTTATGGTTTTGGG - Intronic
1011072848 6:83404618-83404640 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1011089017 6:83573831-83573853 TCTAGGATTTTTATGGTTTTAGG - Intronic
1011158860 6:84365670-84365692 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1011337695 6:86279259-86279281 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1011348488 6:86397608-86397630 TCCAGGGATTTTATGGTTTTAGG - Intergenic
1011358089 6:86493229-86493251 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1011397596 6:86926185-86926207 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1011500882 6:87988411-87988433 TCCAGGGTTTTTATAGCTTTAGG - Intergenic
1011741682 6:90367603-90367625 TCTAGGAGTTTTATGGTATCAGG + Intergenic
1011900447 6:92288305-92288327 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
1011953798 6:93000188-93000210 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1012121956 6:95379864-95379886 TCTAGGAATTTTATGGTTTTAGG - Intergenic
1012217176 6:96601397-96601419 TCCAGGCCTGTTATGTAATTAGG + Intronic
1012513504 6:100031626-100031648 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1012514565 6:100043764-100043786 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1012577081 6:100815800-100815822 TCCAGGATTTTTATAGTTTTAGG - Intronic
1012604695 6:101143725-101143747 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
1012619650 6:101326598-101326620 TCCAGGACTTGAATGACAATAGG - Intergenic
1012686455 6:102256555-102256577 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1012714716 6:102653456-102653478 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1012719965 6:102728559-102728581 TCTAGGATTTTTATGGTGTTAGG + Intergenic
1012882262 6:104804737-104804759 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1012941447 6:105420020-105420042 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1013144677 6:107376917-107376939 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1013710645 6:112893550-112893572 TCCAAAACATTTCTGGCATTTGG - Intergenic
1013889858 6:115013345-115013367 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1013965614 6:115952289-115952311 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1014065741 6:117123290-117123312 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1014132702 6:117852796-117852818 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1014185097 6:118426058-118426080 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1014186030 6:118435078-118435100 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1014306389 6:119747851-119747873 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1014332577 6:120087990-120088012 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1014387782 6:120822732-120822754 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1014409947 6:121102618-121102640 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015258006 6:131201704-131201726 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1015288934 6:131515974-131515996 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1015802534 6:137075172-137075194 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1016074943 6:139784853-139784875 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1016102505 6:140119770-140119792 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1016242322 6:141945157-141945179 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
1016507230 6:144796024-144796046 TCTAGGATTTTTATGGTTTTAGG + Intronic
1016585353 6:145678279-145678301 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1016736051 6:147481374-147481396 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1016988777 6:149914780-149914802 TCCAGGATTTTTATAGTATTAGG + Intergenic
1016994209 6:149949904-149949926 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1017004130 6:150017643-150017665 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1017592398 6:155991678-155991700 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1018073337 6:160186406-160186428 TCTAGGATTTTTATGGTTTTAGG - Intronic
1018110270 6:160530305-160530327 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1018123782 6:160662144-160662166 TCCAGGGCTCATATGGCAATGGG + Intronic
1018128360 6:160704191-160704213 TCTAGGACTCATATGGCAATAGG - Intronic
1020429082 7:8101149-8101171 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1020582801 7:10026861-10026883 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1020690484 7:11348825-11348847 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1020929031 7:14370058-14370080 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1020996592 7:15273239-15273261 TCTAGGATTTTTATGGTTTTAGG + Intronic
1021053096 7:16013485-16013507 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1021064823 7:16160278-16160300 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1021093861 7:16512725-16512747 TCCACGAGGTTTATGGTATTTGG + Intronic
1021305618 7:19028369-19028391 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1021348386 7:19556692-19556714 TCCAGGACTTTTATAGTTTGAGG - Intergenic
1021385536 7:20025372-20025394 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1021388327 7:20059951-20059973 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1021535187 7:21695621-21695643 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1021750995 7:23799618-23799640 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1021780011 7:24095042-24095064 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1022119323 7:27292201-27292223 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1022634005 7:32114497-32114519 TCTAGGGCTTTTATGGCTTTGGG - Intronic
1022641042 7:32183680-32183702 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1022867452 7:34436326-34436348 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1022885352 7:34637884-34637906 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1023051396 7:36255249-36255271 TCTAGGATTTTTATGGTTTTAGG + Intronic
1023183449 7:37509753-37509775 GGCAGCACTTTTATAGCATTTGG + Intergenic
1023385641 7:39654651-39654673 TCTAGAACTTTTGTGGCTTTAGG + Intronic
1024127019 7:46309565-46309587 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1024495965 7:50046176-50046198 TCTAGGATTTTTATGGTTTTAGG - Intronic
1024514378 7:50232556-50232578 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1024773709 7:52757354-52757376 TCCAGGAAATTTATGGCTCTAGG + Intergenic
1025139808 7:56452994-56453016 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1025272596 7:57539133-57539155 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1025520628 7:61725101-61725123 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1025544951 7:62153756-62153778 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1025545488 7:62160806-62160828 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1025557027 7:62322022-62322044 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1025737615 7:64165509-64165531 TCTAGGGTTTTTATGGTATTAGG - Intronic
1025759106 7:64373785-64373807 GCCAGGACTTGTGTGGCACTAGG + Intergenic
1026347417 7:69486124-69486146 TCCTGGACTTTTTAGGCTTTTGG - Intergenic
1027493202 7:78856363-78856385 TCTAGGATTTTTATGGTTTTAGG + Intronic
1027511474 7:79087607-79087629 TCTAGGAATTTTATGGTTTTAGG + Intronic
1028020619 7:85766574-85766596 TCCAGTACTTTTATTACAATTGG + Intergenic
1028056828 7:86255657-86255679 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1028111795 7:86950076-86950098 TCCAGGGCTTTTATGGGCCTGGG - Intronic
1028282188 7:88945200-88945222 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1028321261 7:89462877-89462899 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1028489029 7:91390590-91390612 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1028507691 7:91588166-91588188 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1028524094 7:91764067-91764089 TCTAGGATTTTTATGGTTTTAGG - Intronic
1028785295 7:94785818-94785840 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1028786414 7:94799401-94799423 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1028787854 7:94816925-94816947 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1029021289 7:97367232-97367254 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1029059546 7:97782902-97782924 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1029883866 7:103846456-103846478 TCTAGGATTTTTATGGTTTTAGG - Intronic
1030140358 7:106298020-106298042 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1030200505 7:106898490-106898512 TCCAGGATTTTTATAGTTTTGGG + Intronic
1030243115 7:107351338-107351360 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1030373541 7:108728067-108728089 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1030391902 7:108938646-108938668 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1030400446 7:109042507-109042529 TCCAGGTTTTTTATGGTTTTAGG - Intergenic
1030458231 7:109800002-109800024 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1030500338 7:110351885-110351907 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1030817969 7:114059948-114059970 TCTAGGATTTTTATGGTTTTAGG - Intronic
1030897321 7:115076842-115076864 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1030937138 7:115598606-115598628 TCCAGGCTTTTTATGGTTTTAGG - Intergenic
1030947157 7:115738000-115738022 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1031066224 7:117108201-117108223 TCTAGAACTTTTATGGTATCAGG + Intronic
1031099644 7:117463506-117463528 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1031260842 7:119517943-119517965 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1031590824 7:123590433-123590455 TCTAGGGCTTTTATGGTTTTAGG + Intronic
1031612100 7:123840099-123840121 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1031694568 7:124834134-124834156 TCTAGGATTTTTATGGTTTTAGG - Intronic
1031707135 7:124995339-124995361 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1031717201 7:125124064-125124086 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1031760730 7:125710284-125710306 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1031899973 7:127397933-127397955 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1031908693 7:127490151-127490173 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1032686948 7:134244081-134244103 TCTAGGATTTTTATGGTTTTCGG - Intronic
1032788788 7:135225738-135225760 TTCAGGATTATTTTGGCATTTGG - Intergenic
1032893630 7:136225449-136225471 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1032905444 7:136359459-136359481 TCCAGTACTGTTGTGGGATTTGG - Intergenic
1033708974 7:143918638-143918660 TCCAGGATTTTTATGGTTTGAGG + Intergenic
1033769780 7:144536932-144536954 TCTAGGATTTTTATGGTTTTAGG - Intronic
1033802663 7:144919384-144919406 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
1033819045 7:145111223-145111245 TCCAGGACTTTTAAAGTTTTGGG + Intergenic
1034365935 7:150547669-150547691 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1034394641 7:150812586-150812608 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1034714640 7:153230114-153230136 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1035182680 7:157100965-157100987 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1035237967 7:157511944-157511966 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1035693617 8:1576580-1576602 TCTAGGATTTTTATGGTTTTAGG + Intronic
1035956295 8:4083720-4083742 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1036072925 8:5461956-5461978 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1036097448 8:5739700-5739722 TCCAGGATATTTATGGTTTTAGG + Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1036884621 8:12542549-12542571 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1037023504 8:14003631-14003653 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1037031960 8:14118673-14118695 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1037053152 8:14402400-14402422 TCTAGGATTTTTATGGTTTTAGG + Intronic
1037056064 8:14443690-14443712 TCTAGGATTTTTATGGTTTTAGG - Intronic
1037114286 8:15205136-15205158 TCCAGGGCTTTTATAGTTTTGGG - Intronic
1037133014 8:15429081-15429103 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1038031545 8:23646303-23646325 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1038107208 8:24449761-24449783 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1038117840 8:24577939-24577961 TCTAGGACTTTTATGGTTTTAGG - Intergenic
1038935385 8:32244059-32244081 TCCAGGACTTTTAGGAAATGTGG + Intronic
1039011149 8:33094500-33094522 TCTAGGAATTTTATTGCATTAGG - Intergenic
1039145625 8:34443376-34443398 TCTAGGATTTTTATGGTCTTAGG - Intergenic
1039643055 8:39244885-39244907 TCTAGGATTTTTATGGCTTCAGG - Intronic
1039749890 8:40468528-40468550 TCCAGTACTTTTATAGTTTTAGG - Intergenic
1039808045 8:41019408-41019430 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1040096956 8:43455009-43455031 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1040099441 8:43485073-43485095 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1040355404 8:46612908-46612930 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1040557135 8:48490561-48490583 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1040714860 8:50238521-50238543 TCTAGGATTTTTATAGTATTAGG - Intronic
1040780179 8:51097940-51097962 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1040784126 8:51145574-51145596 TCTAGGAATTTTATGGTTTTAGG - Intergenic
1040805507 8:51391850-51391872 TCTAGGATTTTTATGGTTTTAGG + Intronic
1040942582 8:52847824-52847846 TCGAGGATTTTTATGGTTTTAGG + Intergenic
1040968360 8:53107592-53107614 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1041013568 8:53568875-53568897 TCCAGGGTTTTTATAGCTTTTGG + Intergenic
1041314806 8:56550143-56550165 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1041420606 8:57663571-57663593 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1041612735 8:59870911-59870933 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1041638001 8:60165383-60165405 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1041681351 8:60596177-60596199 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1041911297 8:63091324-63091346 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1041946096 8:63444615-63444637 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1041949097 8:63479991-63480013 TCCAGGATTTGTTTGGAATTTGG + Intergenic
1041951275 8:63505865-63505887 TCTAGGGTTTTTATGGCGTTAGG + Intergenic
1042046220 8:64655050-64655072 TCCAGGGCTTTTATAGTTTTGGG - Intronic
1042069241 8:64912612-64912634 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1042070346 8:64926432-64926454 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1042073333 8:64960582-64960604 TCCAGGGCTTTTATGGTTTTAGG - Intergenic
1042179434 8:66071081-66071103 TCTAGGATTTTTATGGTACTAGG - Intronic
1042713213 8:71742624-71742646 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1042871306 8:73402270-73402292 TCCAGGAGTTTTATAGTTTTGGG - Intergenic
1042914536 8:73862456-73862478 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1043046387 8:75329100-75329122 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1043175762 8:77021740-77021762 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1043237508 8:77886954-77886976 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1043336709 8:79185136-79185158 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1043343338 8:79268670-79268692 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1043522012 8:81056599-81056621 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1043592951 8:81851060-81851082 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1043725581 8:83606447-83606469 TCTAGGGATTTTATGGCTTTAGG - Intergenic
1043729914 8:83664134-83664156 TCCCAGACTTTTTTGCCATTAGG - Intergenic
1043748462 8:83905585-83905607 TCGAGGGCTTTTATGGTTTTAGG + Intergenic
1043806108 8:84673482-84673504 TCCAGGATTTTTATAGGTTTGGG + Intronic
1043929742 8:86076984-86077006 TCTAGGACTTTTATGGTCCTAGG + Intronic
1044035939 8:87303516-87303538 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1044060518 8:87629707-87629729 TCTAGGGCTTTTATGGCTTTAGG - Intergenic
1044161082 8:88915836-88915858 TCCAGGGCTGTTATGGCTGTTGG - Intergenic
1044165371 8:88976018-88976040 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1044168812 8:89023405-89023427 TCTAGGATTTTTATGGCTTTAGG + Intergenic
1044170642 8:89047674-89047696 TCCAGGATTTTTACAGCTTTAGG + Intergenic
1044176985 8:89138312-89138334 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1044207719 8:89510717-89510739 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1044405690 8:91823519-91823541 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
1044432097 8:92120696-92120718 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1044440275 8:92216023-92216045 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1044455908 8:92392912-92392934 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1044566586 8:93668643-93668665 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1044772933 8:95656335-95656357 TCCAGGATTTTTATGGTTTGAGG + Intergenic
1045086799 8:98695458-98695480 TCTAGGATTTTTATGGTTTTAGG + Intronic
1045157101 8:99488995-99489017 TCTAGGATTTTTATGGTTTTAGG + Intronic
1045419987 8:102004909-102004931 TCTAGGATTTTTATGGTTTTAGG - Intronic
1045570753 8:103366905-103366927 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1045595789 8:103653972-103653994 TACAGGAATTTTATGACATAAGG + Intronic
1045596648 8:103664158-103664180 TCTAGGGTTTTTATGGTATTAGG - Intronic
1045789916 8:105971218-105971240 TCCAGGGATTTTATAGCTTTGGG - Intergenic
1045794640 8:106028324-106028346 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1045938668 8:107713037-107713059 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1045964890 8:108013730-108013752 TCTAGGGCTTTTATGGTCTTGGG - Intronic
1046218445 8:111180799-111180821 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1046296129 8:112220774-112220796 TCCAGGGTTTTTATGGTGTTAGG - Intergenic
1046323161 8:112604668-112604690 TTCAGAACTTTTATAGCTTTAGG - Intronic
1046608366 8:116395749-116395771 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1046688559 8:117256003-117256025 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1047154231 8:122298937-122298959 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1047230466 8:122993971-122993993 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1047346045 8:124029876-124029898 TCTAGGATTTTTATGGTTTTGGG + Intronic
1047736519 8:127770256-127770278 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1047859986 8:128955191-128955213 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1047922191 8:129646834-129646856 TCTAGGATTTTTATGGTGTTAGG - Intergenic
1047929975 8:129718052-129718074 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1048126360 8:131640058-131640080 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1048151263 8:131897070-131897092 TACAAGACTTTTATGACAATTGG - Intergenic
1048655203 8:136528535-136528557 TCGAGGACTCTTATGGCCATGGG - Intergenic
1049136247 8:140903091-140903113 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1049882241 8:145073463-145073485 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1050082748 9:1932202-1932224 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1050246407 9:3694729-3694751 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1050390440 9:5137618-5137640 TCCAGGTTTTTTATGGATTTAGG - Intronic
1050403437 9:5281664-5281686 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1050404942 9:5298046-5298068 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1050411339 9:5368986-5369008 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1050492849 9:6207556-6207578 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1050603711 9:7278798-7278820 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1050783522 9:9369722-9369744 TCTAGGATTTTTATGGTTTTAGG + Intronic
1050805861 9:9677240-9677262 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1050817943 9:9838878-9838900 TCTAGGATTTTTATGGTTTTAGG + Intronic
1050825155 9:9936107-9936129 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1050921969 9:11214962-11214984 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1051496526 9:17729572-17729594 TCTAGGATTTTTATGGTTTTAGG + Intronic
1051537986 9:18181165-18181187 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1051549191 9:18310216-18310238 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1051575684 9:18612750-18612772 TCCAGGATTTTTATAGTTTTAGG - Intronic
1051656716 9:19388944-19388966 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1051670021 9:19500255-19500277 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1051676725 9:19565994-19566016 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1051867567 9:21698294-21698316 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1051913567 9:22182015-22182037 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1052139796 9:24966451-24966473 TCCAGAATTTTTATGGTTTTAGG - Intergenic
1052247513 9:26354338-26354360 TCTAGGAGTTTTGTGGCTTTAGG - Intergenic
1052335847 9:27319109-27319131 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1052511798 9:29431638-29431660 CCCAGGAGTTTTATGGCTTCAGG + Intergenic
1052650845 9:31298962-31298984 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1052652364 9:31321255-31321277 TCCAGGGCTTTTATGGGCCTTGG + Intergenic
1052667562 9:31514497-31514519 TCGAGGATTTTTATGGTTTTAGG + Intergenic
1053542571 9:38989836-38989858 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1053631141 9:39939917-39939939 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1053774628 9:41523588-41523610 TCCAGAATTTTTATGGTTTTGGG - Intergenic
1053807027 9:41813353-41813375 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1054212746 9:62310781-62310803 TCCAGAATTTTTATGGTTTTGGG - Intergenic
1054355963 9:64063230-64063252 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1054623565 9:67374074-67374096 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1054889812 9:70239026-70239048 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1054960969 9:70968891-70968913 TCTAGGATTTTTATGGTTTTAGG - Intronic
1054981059 9:71206697-71206719 TCTAGGATTTTTATGGTTTTAGG + Intronic
1055147449 9:72953689-72953711 AGCAGGACTTTTAGGGAATTCGG + Intronic
1055338237 9:75254800-75254822 TCTAGGATTTTTATGGTTTTTGG + Intergenic
1055408398 9:75999804-75999826 TCTAGGAATTTTATGGTTTTAGG - Intronic
1055784158 9:79854334-79854356 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1056127469 9:83550061-83550083 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1056292955 9:85162187-85162209 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1056671444 9:88631464-88631486 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1056734735 9:89199554-89199576 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1057175476 9:92994585-92994607 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1057343166 9:94221764-94221786 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1057375660 9:94520067-94520089 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1057451009 9:95160139-95160161 TCTAGGATTTTTATGGTTTTAGG + Intronic
1057460770 9:95259571-95259593 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1057639758 9:96807442-96807464 TCTGGGACTTTTATGGTTTTGGG - Intergenic
1057905865 9:98982942-98982964 TCCACCACTTTTTAGGCATTTGG + Intronic
1058122277 9:101152510-101152532 TCTAGGGTTTTTATGGCTTTAGG + Intronic
1058185675 9:101851723-101851745 TCCAGGGTTTTTATGGTTTTCGG + Intergenic
1058222484 9:102319478-102319500 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1058251006 9:102695948-102695970 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1058276284 9:103045741-103045763 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1058310199 9:103491119-103491141 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1058318302 9:103597007-103597029 TACAGCACTTTTATGGCTTGTGG - Intergenic
1058493508 9:105528660-105528682 TCCAGGATTTTTATGGTTTTAGG - Intronic
1058511992 9:105729192-105729214 TCCAGGGATTTTATGGTTTTAGG + Intronic
1058512287 9:105732420-105732442 TCCAGGGATTTTATGGTTTTAGG + Intronic
1058513524 9:105745699-105745721 TCTAGGATTTTTATGGTTTTAGG + Intronic
1058570465 9:106336682-106336704 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1058609938 9:106764584-106764606 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1058905653 9:109480641-109480663 TCTAGGAGTTTTATGGCTTTAGG + Intronic
1058929150 9:109701623-109701645 TCTAGGATTTTTATGGTTTTAGG - Intronic
1059608152 9:115858997-115859019 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1059704609 9:116809803-116809825 TCCTGGACTTGCATTGCATTGGG + Intronic
1059818071 9:117940414-117940436 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1059864236 9:118496590-118496612 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1059865488 9:118509561-118509583 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1059976872 9:119727107-119727129 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1060133501 9:121128753-121128775 TCTAGGATTTTTATGGTTTTAGG + Intronic
1060168051 9:121436427-121436449 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1060851636 9:126881641-126881663 TGAAGAAATTTTATGGCATTTGG - Exonic
1062742892 9:138190390-138190412 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1202797054 9_KI270719v1_random:131344-131366 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1203438476 Un_GL000195v1:165713-165735 TTTAGGTCTTTTATGACATTGGG + Intergenic
1203688623 Un_GL000214v1:20933-20955 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1203447031 Un_GL000219v1:66477-66499 TCTAGGTTTTTTATGGTATTAGG + Intergenic
1203380518 Un_KI270435v1:33245-33267 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1203372305 Un_KI270442v1:319874-319896 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1203394297 Un_KI270512v1:10542-10564 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1203399925 Un_KI270519v1:77755-77777 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1203647652 Un_KI270751v1:83120-83142 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1203652786 Un_KI270751v1:143621-143643 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1186061636 X:5714520-5714542 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1186420215 X:9419725-9419747 ACCAGGACTCTTGTGGCTTTAGG - Intergenic
1186960626 X:14732990-14733012 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1187117262 X:16365086-16365108 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1187298995 X:18029951-18029973 TTATGGACTTTTATGACATTGGG + Intergenic
1187530165 X:20089096-20089118 TCTAGAAGTTTTATGGCTTTAGG + Intronic
1187596269 X:20776195-20776217 TCTAGGGCTTTTATGGGTTTAGG - Intergenic
1187728582 X:22229852-22229874 TCTAGGATTTTTATGGCTTTAGG + Intronic
1187936179 X:24338309-24338331 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1188014363 X:25091740-25091762 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1188052212 X:25501936-25501958 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1188125852 X:26367913-26367935 TCCAGGACTTTTATGGTTATAGG + Intergenic
1188256172 X:27964240-27964262 TCCAGGGCTTTTGTGGTTTTAGG - Intergenic
1188292010 X:28401067-28401089 TCCAGGGCTTTTATGGTTTTAGG - Intergenic
1188296996 X:28461743-28461765 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1188462332 X:30443061-30443083 TCCAGGGCTTTTATGGTTTTGGG - Intergenic
1188659070 X:32735795-32735817 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1188825406 X:34826702-34826724 TCAAGGAATTTTATGGCTTCAGG - Intergenic
1188959659 X:36475248-36475270 TACAGGGCTTTTATAGCTTTAGG - Intergenic
1189501724 X:41567117-41567139 TCCAGGGTTTTTATGGTTTTAGG - Intronic
1189542720 X:42009193-42009215 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1189734124 X:44051983-44052005 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1189886469 X:45550250-45550272 TCCAGAAGTTTTATAGCTTTAGG - Intergenic
1189992533 X:46608505-46608527 TATAGGACTTTTATCTCATTGGG - Intronic
1190151321 X:47952241-47952263 TCCAGGAGTTTTATGGTTTCAGG - Intronic
1190305338 X:49078756-49078778 TCCAGGCCATGTCTGGCATTGGG - Intronic
1190358731 X:49629407-49629429 TCTAGGACTTTTATGGTCCTAGG + Intergenic
1190513909 X:51203280-51203302 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1190593297 X:52026754-52026776 TCTGGGAATTTTATGGCTTTAGG + Intergenic
1190599282 X:52072958-52072980 TCCAGGGTTTTTATGGTGTTGGG + Intergenic
1190604250 X:52124179-52124201 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
1190609542 X:52181115-52181137 TCCAGGGTTTTTATGGTGTTGGG - Intergenic
1190636850 X:52443241-52443263 TCCAGGATTTTTATGTTTTTAGG + Intergenic
1190958196 X:55218176-55218198 TCCAGGATTTTTATAGTTTTAGG + Intronic
1190965193 X:55293161-55293183 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1191075998 X:56453994-56454016 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1191081309 X:56512988-56513010 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1191113565 X:56828478-56828500 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1191139343 X:57099632-57099654 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1191145284 X:57158955-57158977 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1191153011 X:57241230-57241252 TCCAGGATTTTTATAGTTTTTGG - Intergenic
1191164790 X:57377258-57377280 TCCAGGATTTTTATGGTTTTAGG + Intronic
1191176421 X:57506757-57506779 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1191627782 X:63287114-63287136 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1191646153 X:63483343-63483365 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1191647433 X:63497117-63497139 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1191679590 X:63827191-63827213 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1191733924 X:64368638-64368660 TCTAGGGTTTTTATGGCTTTAGG - Intronic
1191738170 X:64409154-64409176 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1191777589 X:64833325-64833347 TCCAGGGCTTTTATAGTTTTGGG + Intergenic
1191787139 X:64928234-64928256 TCTAGGAATTTTATGGTTTTAGG + Intronic
1191804482 X:65119758-65119780 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1191809586 X:65172536-65172558 TCTAGGATTTTTATGGTTTTGGG + Intergenic
1191827704 X:65383482-65383504 TCTAGGGTTTTTATGGTATTAGG - Intronic
1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG + Intergenic
1191893265 X:65966547-65966569 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1191942341 X:66494576-66494598 TCTAAGACTTTTATGGTTTTAGG - Intergenic
1191944728 X:66519837-66519859 TCCAGGGTTTTTATAGGATTGGG + Intergenic
1191985685 X:66978035-66978057 TCTAGGATTTTTATGGATTTAGG - Intergenic
1191987021 X:66993051-66993073 TCCAGGGTTTTTATGGCCCTAGG + Intergenic
1192060591 X:67821373-67821395 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1192285694 X:69733212-69733234 TCCAGGGGTTTTATGGTTTTAGG + Intronic
1192294389 X:69832149-69832171 TCTAGGATTTTTATGGTTTTAGG + Intronic
1192406957 X:70895901-70895923 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1192527009 X:71855672-71855694 TCCAGGACTTTTATAGTTTGGGG + Intergenic
1192613361 X:72590454-72590476 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1192628401 X:72754347-72754369 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1192636685 X:72826330-72826352 TCTAGGATTTTTATGGTTTTAGG + Intronic
1192645029 X:72894484-72894506 TCTAGGATTTTTATGGTTTTAGG - Intronic
1192653307 X:72966463-72966485 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1192697177 X:73429734-73429756 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1192754682 X:74035050-74035072 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1192760930 X:74095728-74095750 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1192802069 X:74475592-74475614 TCTAGGATTTTTATGGTTTTAGG + Intronic
1192852412 X:74971298-74971320 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1192879358 X:75266469-75266491 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1192900856 X:75494812-75494834 TCTAGGATTTTTATGGTTTTAGG - Intronic
1192932244 X:75819207-75819229 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1192978706 X:76315856-76315878 TTCAGGGCTTTTATGGTTTTAGG + Intergenic
1193001988 X:76573082-76573104 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1193039851 X:76993374-76993396 TCCAGGGTTTTTATGGCTCTAGG + Intergenic
1193051151 X:77101191-77101213 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1193059732 X:77192601-77192623 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1193089157 X:77475645-77475667 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1193095394 X:77542847-77542869 TCTAGGATTTTTATGGTTTTAGG - Intronic
1193163877 X:78259755-78259777 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1193199984 X:78677642-78677664 TCCAGGATTTTTATAGTTTTTGG - Intergenic
1193215142 X:78855083-78855105 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1193259744 X:79391551-79391573 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1193263302 X:79436697-79436719 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1193268282 X:79499156-79499178 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1193339060 X:80324456-80324478 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1193400784 X:81039634-81039656 TCTAGGGCTTTTATGGTTTTTGG - Intergenic
1193542894 X:82793330-82793352 TCCAGGGCTTTTATGGTTTTAGG - Intergenic
1193589263 X:83367199-83367221 TCTAGGGCTTTTATGGTTTTGGG + Intergenic
1193594298 X:83427100-83427122 TCCAGGCTTTTTATGGTATTGGG - Intergenic
1193685892 X:84576560-84576582 TCTAGGATTGTTATGGCTTTAGG - Intergenic
1193883343 X:86954437-86954459 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1193923562 X:87458921-87458943 TCCAGGGTTTTTATAGTATTGGG - Intergenic
1193967708 X:88008861-88008883 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1194028398 X:88782527-88782549 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1194040397 X:88934853-88934875 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1194075359 X:89385380-89385402 TCTAGAACTTTTATGGCTTCAGG + Intergenic
1194145033 X:90251787-90251809 TCCAGGATTTTTATAGATTTGGG - Intergenic
1194250882 X:91573384-91573406 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1194322750 X:92472214-92472236 TCCAGGAATTTTATAGTTTTGGG + Intronic
1194508619 X:94764693-94764715 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1194509764 X:94779427-94779449 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1194547993 X:95261943-95261965 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1194664351 X:96661035-96661057 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1194927399 X:99841909-99841931 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1195162816 X:102187289-102187311 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1195179940 X:102348312-102348334 TCCAGGGCTTTTATAGTTTTAGG + Intergenic
1195198697 X:102524965-102524987 TCTAGGGCTTTTATGGTTTTGGG - Intergenic
1195400514 X:104456554-104456576 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1195475495 X:105280308-105280330 TCTAGGACTTTTATGGTCCTAGG - Intronic
1195569562 X:106383347-106383369 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1195602695 X:106766827-106766849 TCTAGGATTTTTATGGTTTTAGG + Intronic
1195798761 X:108683006-108683028 TCTAGGATTTTTATGGTTTTAGG + Intronic
1195825860 X:108999860-108999882 TCTAGGGTTTTTATGGCTTTTGG + Intergenic
1195833315 X:109084447-109084469 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1195845662 X:109225207-109225229 TCTAGGGTTTTTATGGCTTTGGG - Intergenic
1196037452 X:111161578-111161600 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1196094978 X:111789444-111789466 TCTAGGATTTTTGTGGCTTTAGG - Intronic
1196180573 X:112685376-112685398 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1196181455 X:112695431-112695453 TCTAGGAGTTTTATAGTATTGGG + Intergenic
1196494872 X:116312805-116312827 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1196530181 X:116777544-116777566 TCCAGGGCTTTTATAGTTTTGGG - Intergenic
1196591893 X:117495311-117495333 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1196606824 X:117666635-117666657 TCTAGGGTTTTTATGGCTTTGGG + Intergenic
1196631034 X:117940053-117940075 TCCAGGGTTTTTATGGTTTTAGG + Intronic
1196993201 X:121350783-121350805 TCCAGGACTTTTATAGTTTTGGG - Intergenic
1197006828 X:121512265-121512287 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1197031962 X:121827439-121827461 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1197142788 X:123134968-123134990 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1197184102 X:123567438-123567460 TCTAGGATTTTTATGGTCTTAGG - Intergenic
1197242824 X:124137868-124137890 TCCAGGATTTTTATAGTTTTAGG + Intronic
1197395010 X:125916701-125916723 TCCAGGATTTTTATGGTTTGGGG + Intergenic
1197398341 X:125956286-125956308 TCCAGAGCTTATATAGCATTTGG + Intergenic
1197416880 X:126186334-126186356 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1197430867 X:126361942-126361964 TCTAGGATTTTTATGGCTTTAGG + Intergenic
1197505569 X:127299436-127299458 TCCAGGGTTTTTATGATATTGGG - Intergenic
1197575309 X:128203954-128203976 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1198165643 X:134053006-134053028 TCCAGGGTTTTTATGGTTTTGGG + Intergenic
1198407880 X:136333218-136333240 TCTAGGATTTTTATGGTTTTAGG - Intronic
1198579103 X:138043980-138044002 TCCAGGAATTTTATAGTTTTGGG - Intergenic
1198785840 X:140286967-140286989 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1199022053 X:142892583-142892605 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1199022553 X:142899078-142899100 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1199120896 X:144052730-144052752 TCCAGGCTTTTTATAGCTTTTGG - Intergenic
1199186970 X:144926545-144926567 TCTAGGATTTTTATGGTTTTGGG - Intergenic
1199197093 X:145044276-145044298 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1199466151 X:148139799-148139821 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1199475440 X:148239967-148239989 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1199636288 X:149815501-149815523 TCTAGGACTTTTATCGTTTTAGG - Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1199889337 X:152059648-152059670 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1199904886 X:152215625-152215647 TCTAGTAATTTTATAGCATTGGG - Intronic
1199923781 X:152439902-152439924 TCTAGGAATTTTATGGTTTTAGG - Intronic
1200271640 X:154690296-154690318 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1200335005 X:155341213-155341235 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200351462 X:155500008-155500030 TCCAGGATTTTTATGGTTTTAGG - Intronic
1200417119 Y:2923995-2924017 TCTAGGGCTTTTATGGTTTTAGG - Intronic
1200490794 Y:3821081-3821103 TCCAGGATTTTTATAGATTTGGG - Intergenic
1200569827 Y:4814631-4814653 TCTAGGATTTTTATGGTTTTAGG - Intergenic
1200630905 Y:5585691-5585713 TCCAGGAATTTTATAGTTTTGGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG + Intergenic
1200730958 Y:6739540-6739562 TCTAGAACTTTTATGGCTTCAGG + Intergenic
1200748658 Y:6924694-6924716 ACCTGGACTTTTATGGCAGCTGG - Intronic
1200778366 Y:7191127-7191149 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1200858614 Y:7965929-7965951 TCCAGGACTTGTGTGGTACTGGG - Intergenic
1200870935 Y:8097574-8097596 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200900329 Y:8425072-8425094 TCTAGGGCTTTTATGGTTTTAGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201013662 Y:9575647-9575669 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1201047875 Y:9906124-9906146 TCCAGGACATTAACGGCATTGGG - Intergenic
1201066063 Y:10095521-10095543 TCCAGGGCTTTTATAGTTTTGGG + Intergenic
1201248896 Y:12035744-12035766 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1201253377 Y:12083532-12083554 TCTAGGGTTTTTATGGTATTAGG - Intergenic
1201371043 Y:13264855-13264877 TCCAGGGTTTTTATGGTTTTTGG + Intronic
1201409542 Y:13685457-13685479 TCTAGGGATTTTATGGCTTTAGG - Intergenic
1201421835 Y:13807842-13807864 TCAAGGACTTTTATGATTTTAGG + Intergenic
1201498375 Y:14614547-14614569 TCTAGGATTTTTATGGTTTTAGG + Intronic
1201544811 Y:15150172-15150194 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1201602195 Y:15743454-15743476 TCTAGGGTTTTTATGGCTTTAGG + Intergenic
1201730666 Y:17199279-17199301 TCCAGGATTTTTATGGTTTCAGG + Intergenic
1201751835 Y:17440806-17440828 TCTAGGGTTTTTATGGTATTAGG + Intergenic
1201888520 Y:18915506-18915528 TCTAGGGCTTTTATGGTTTTAGG - Intergenic
1201908597 Y:19110034-19110056 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1201990547 Y:20020121-20020143 TCTAGGGTTTTTATGGCTTTTGG - Intergenic
1202017865 Y:20431088-20431110 TCTAGGGTTTTTATGGCTTTAGG - Intergenic
1202057724 Y:20852865-20852887 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1202068579 Y:20967041-20967063 TCTAGAATTTTTATGGCTTTTGG - Intergenic
1202075168 Y:21030308-21030330 TCTAGGATTTTTATGGTTTTAGG + Intergenic
1202171207 Y:22045940-22045962 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1202220155 Y:22540433-22540455 TCCAGGGTTTTTATGGTTTTAGG + Intergenic
1202322959 Y:23655230-23655252 TCCAGGGTTTTTATGGTTTTAGG - Intergenic
1202547813 Y:26014826-26014848 TCCAGGGTTTTTATGGTTTTAGG + Intergenic