ID: 1088617746

View in Genome Browser
Species Human (GRCh38)
Location 11:111648341-111648363
Sequence CACCATTGGCACCTTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 2, 2: 8, 3: 116, 4: 611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088617746_1088617750 5 Left 1088617746 11:111648341-111648363 CCTAGATCAAGGTGCCAATGGTG 0: 1
1: 2
2: 8
3: 116
4: 611
Right 1088617750 11:111648369-111648391 TAAGGACCCACTTTCTCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088617746 Original CRISPR CACCATTGGCACCTTGATCT AGG (reversed) Intronic
900403979 1:2484404-2484426 CCCCATTGGCACCTCGACCAGGG - Intronic
900866045 1:5269404-5269426 CTCCACCAGCACCTTGATCTTGG - Intergenic
900867996 1:5282522-5282544 CACTGTGGGCAGCTTGATCTTGG + Intergenic
900882411 1:5391519-5391541 CACCATTGGCACCATCACCCTGG + Intergenic
902183178 1:14705085-14705107 CCCTTCTGGCACCTTGATCTTGG - Intronic
902416077 1:16240254-16240276 CTCTGCTGGCACCTTGATCTTGG - Intergenic
903057241 1:20644738-20644760 CTCCATGTGCACCTTGATCAGGG + Intronic
903275113 1:22216682-22216704 TACCAGTGGCCCCTTGACCTGGG + Intergenic
903820867 1:26101533-26101555 ATCTACTGGCACCTTGATCTTGG + Intergenic
903923025 1:26814587-26814609 CCCTGCTGGCACCTTGATCTTGG + Intergenic
905503997 1:38462136-38462158 CCTCACTAGCACCTTGATCTTGG + Intergenic
905854698 1:41301639-41301661 CGATGTTGGCACCTTGATCTTGG + Intergenic
906071981 1:43023637-43023659 CACCACTGGTACCTTTATCAAGG + Intergenic
907383196 1:54108545-54108567 ACCCACTGACACCTTGATCTTGG + Intronic
907950607 1:59179632-59179654 CCCCATGGACACCTTGACCTTGG - Intergenic
908076151 1:60521131-60521153 CTCTGCTGGCACCTTGATCTTGG - Intergenic
908081167 1:60580103-60580125 CCCCACCGACACCTTGATCTCGG - Intergenic
908466332 1:64399707-64399729 CCCCATCAGTACCTTGATCTTGG - Intergenic
909721431 1:78775437-78775459 CCCTTCTGGCACCTTGATCTTGG + Intergenic
910442719 1:87268981-87269003 ATCTGTTGGCACCTTGATCTTGG + Intergenic
910551222 1:88477608-88477630 AACCATGGGCACCCTGATCTTGG + Intergenic
911105120 1:94123858-94123880 ATCTATTGGCACCTTGATCTTGG - Intergenic
911367314 1:96954262-96954284 GCCCATTGACACCTTGATTTTGG - Intergenic
911378044 1:97075701-97075723 ATCTACTGGCACCTTGATCTTGG + Intergenic
912251908 1:108020539-108020561 CACCATGGCCACCTTGTTCATGG + Intergenic
912568334 1:110604982-110605004 CAGCATTGGCAGCCTGACCTGGG + Intronic
912841203 1:113041179-113041201 CCTCTTTGGCAGCTTGATCTTGG - Intergenic
913661840 1:121011486-121011508 CCATGTTGGCACCTTGATCTCGG - Intergenic
913967708 1:143390993-143391015 CAGCACTGGCACCCTGATCTTGG + Intergenic
914013213 1:143794671-143794693 CCATGTTGGCACCTTGATCTCGG - Intergenic
914062086 1:144216583-144216605 CAGCACTGGCACCCTGATCTTGG + Intergenic
914117064 1:144749771-144749793 CAGCACTGGCACCCTGATCTTGG - Intergenic
914164613 1:145166514-145166536 CCATGTTGGCACCTTGATCTCGG + Intergenic
914342884 1:146775385-146775407 TTCTGTTGGCACCTTGATCTTGG - Intergenic
914651837 1:149703280-149703302 CCATGTTGGCACCTTGATCTCGG - Exonic
915742610 1:158130575-158130597 CAACCTTGGAACCTTGATTTTGG - Intergenic
915933018 1:160071700-160071722 CACCATTGCCACGCTGATTTGGG - Intergenic
916117193 1:161496071-161496093 CCCTACTGACACCTTGATCTTGG + Intergenic
916287658 1:163128766-163128788 CAGCATTGGCACTTTGTTCATGG - Intronic
916657815 1:166892956-166892978 CCCTGTTGGCACCTTGATTTTGG + Intergenic
917005041 1:170405696-170405718 AACTGCTGGCACCTTGATCTTGG + Intergenic
917679461 1:177351119-177351141 CCCTTCTGGCACCTTGATCTTGG - Intergenic
918728658 1:187960665-187960687 ATCTATTGGCACCTTGAGCTTGG - Intergenic
918790890 1:188826527-188826549 ACCTATTGGCACTTTGATCTTGG + Intergenic
918823226 1:189286314-189286336 TACCATTGCCACCTACATCTTGG - Intergenic
919265641 1:195261225-195261247 CCCTACTGACACCTTGATCTTGG - Intergenic
920156132 1:203953182-203953204 CAACCCTGGCACCTTGATCTTGG - Intergenic
921048630 1:211494975-211494997 ATCTACTGGCACCTTGATCTTGG + Intergenic
921260828 1:213383849-213383871 GTCAACTGGCACCTTGATCTTGG + Intergenic
922131973 1:222788799-222788821 ATCTACTGGCACCTTGATCTTGG + Intergenic
922173485 1:223176977-223176999 ACCTGTTGGCACCTTGATCTTGG + Intergenic
922197559 1:223372833-223372855 CCCTGCTGGCACCTTGATCTTGG - Intergenic
922449576 1:225725990-225726012 CTCCATTGCCACCATGGTCTGGG - Intergenic
922527043 1:226311987-226312009 CAACATTGGCACCTTGATCTTGG - Intergenic
923253458 1:232198603-232198625 CACCATGGCCACTTTGTTCTTGG + Intergenic
923449995 1:234107448-234107470 CCCTGCTGGCACCTTGATCTTGG - Intronic
923775769 1:236977314-236977336 ACCCGCTGGCACCTTGATCTTGG - Intergenic
924152909 1:241146799-241146821 ATCCACTGTCACCTTGATCTTGG - Intronic
924847025 1:247784296-247784318 CACCATGGCCACCTTGTTCATGG + Intergenic
1063058487 10:2526613-2526635 ACCCACTGGCACCTTGATCTCGG + Intergenic
1063210011 10:3871791-3871813 AACGGTTGGCACCTTGAGCTTGG + Intergenic
1063515344 10:6689690-6689712 CAGCTCTGGCACCTTGATCTTGG - Intergenic
1063566767 10:7177993-7178015 CAACCCTGGCACCTTCATCTTGG + Intronic
1064447877 10:15412648-15412670 CCCTGTAGGCACCTTGATCTTGG - Intergenic
1064545188 10:16443165-16443187 CACTGCTGACACCTTGATCTGGG - Intronic
1065492492 10:26296062-26296084 ATCTACTGGCACCTTGATCTTGG - Intronic
1065535926 10:26714620-26714642 TATCACTGGCACCTGGATCTTGG + Intronic
1066404546 10:35106247-35106269 CACCAGACACACCTTGATCTTGG + Intergenic
1066454166 10:35558768-35558790 CCCCACTAACACCTTGATCTTGG + Intronic
1067549058 10:47220531-47220553 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1068207428 10:53873957-53873979 ATCTATTAGCACCTTGATCTTGG + Intronic
1068359960 10:55965044-55965066 CATTGTTGGTACCTTGATCTTGG - Intergenic
1068564556 10:58558764-58558786 TACTGTTAGCACCTTGATCTTGG - Intronic
1068982857 10:63079655-63079677 CACCAGTAGCACCCAGATCTTGG + Intergenic
1069568972 10:69482942-69482964 CAACCCTGCCACCTTGATCTTGG - Intronic
1069918705 10:71803020-71803042 CTCCATTGGGACCTTCATCCTGG - Exonic
1070339584 10:75484820-75484842 CCCTGATGGCACCTTGATCTTGG + Intronic
1070403626 10:76075419-76075441 CCCTGTGGGCACCTTGATCTTGG + Intronic
1070557745 10:77542165-77542187 AACCACAAGCACCTTGATCTTGG + Intronic
1070643279 10:78184238-78184260 CCCCAGTGGCACCTTGATCTTGG + Intergenic
1071184972 10:83032437-83032459 TTCCGTTGACACCTTGATCTTGG - Intergenic
1071262660 10:83934983-83935005 ATCTGTTGGCACCTTGATCTTGG - Intergenic
1071509440 10:86251954-86251976 CAGCAGTGGCACCTGCATCTTGG + Intronic
1074062278 10:109977709-109977731 CCCCATTGGGACTTTGAACTGGG + Intergenic
1074088180 10:110224524-110224546 CATCATTGACATTTTGATCTGGG - Intronic
1074218609 10:111412850-111412872 AACCATTGACAGCTTTATCTTGG - Intergenic
1074713860 10:116200599-116200621 CCCCGTTGGCACCAGGATCTTGG - Intronic
1074817480 10:117153566-117153588 CTCTAATGGCACCCTGATCTTGG - Intergenic
1074983463 10:118637972-118637994 ACCCTTTGGCACCTTGATGTTGG + Intergenic
1075682771 10:124344223-124344245 CCCTACTGGCCCCTTGATCTTGG - Intergenic
1076087218 10:127644244-127644266 TCCTATTAGCACCTTGATCTTGG + Intergenic
1076381221 10:130025610-130025632 ACCTATTGGCACCTTGATCTTGG + Intergenic
1076657602 10:132035407-132035429 CCCCATCAGCACCTTGATCTTGG + Intergenic
1077275432 11:1704606-1704628 GAATACTGGCACCTTGATCTGGG - Intergenic
1077493502 11:2873352-2873374 TTGCACTGGCACCTTGATCTTGG - Intergenic
1077804805 11:5579916-5579938 AACTATTGGCTGCTTGATCTTGG - Intronic
1079075559 11:17383459-17383481 ATCCACTGGCACCTTGATCTTGG + Intergenic
1079702141 11:23561518-23561540 CCTTACTGGCACCTTGATCTTGG + Intergenic
1079794956 11:24789687-24789709 CACTGCTGGCATCTTGATCTTGG - Intronic
1080038090 11:27730095-27730117 CCTGGTTGGCACCTTGATCTTGG + Intergenic
1080116435 11:28626416-28626438 CACTGGTGGCACCTTGATCTTGG - Intergenic
1080195675 11:29605763-29605785 ATCTTTTGGCACCTTGATCTTGG - Intergenic
1080251171 11:30235484-30235506 ATCCGCTGGCACCTTGATCTTGG - Intergenic
1080310866 11:30890117-30890139 CCCAGCTGGCACCTTGATCTTGG + Intronic
1080742155 11:35076397-35076419 CAGCCTTGGCACCCTCATCTTGG - Intergenic
1081678727 11:44987141-44987163 AATCACTGGCATCTTGATCTTGG - Intergenic
1081747259 11:45481973-45481995 CCCCATTGGCACCTTCATGGAGG - Intergenic
1081804465 11:45882936-45882958 CTCCACTGGCAGGTTGATCTGGG - Exonic
1082681892 11:56184060-56184082 ATCTACTGGCACCTTGATCTTGG - Intergenic
1083102784 11:60327367-60327389 AACCTGTGGCACCTTGATCGTGG + Intergenic
1083974662 11:66108174-66108196 CCCTACTGGCACCTTAATCTTGG - Intronic
1084075261 11:66770199-66770221 ATCAACTGGCACCTTGATCTTGG + Intronic
1084582999 11:70036138-70036160 CCTGATTGGCACCTTGATTTTGG - Intergenic
1084709843 11:70837076-70837098 CAAGGCTGGCACCTTGATCTTGG + Intronic
1085250233 11:75138609-75138631 ATCCACTGGCACCTTGATCTTGG - Intronic
1085598841 11:77836481-77836503 TCCTATTGGCACCTTGATCTTGG + Intronic
1086854677 11:91852009-91852031 AGCCACTGACACCTTGATCTTGG - Intergenic
1086900461 11:92361576-92361598 CACTGCTGGCACCTTGATGTTGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087868010 11:103257262-103257284 ATCTGTTGGCACCTTGATCTTGG + Intronic
1088129157 11:106466078-106466100 CCCCTTCGACACCTTGATCTTGG + Intergenic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1088816965 11:113428042-113428064 CCCTGTTGACACCTTGATCTGGG + Intronic
1088922401 11:114270594-114270616 CCCTACTGGCACCTTGGTCTTGG - Intronic
1089639527 11:119838638-119838660 ATCTACTGGCACCTTGATCTTGG - Intergenic
1091634295 12:2185673-2185695 CCCTGCTGGCACCTTGATCTTGG + Intronic
1091880246 12:3971276-3971298 CACTGCTGGCACCTTGATCTTGG + Intergenic
1092074992 12:5665601-5665623 CACCATTGGCTCCTGGGTCCTGG - Intronic
1093129797 12:15376643-15376665 ACCTGTTGGCACCTTGATCTTGG - Intronic
1093430982 12:19084587-19084609 CCCTATTGACAACTTGATCTTGG + Intergenic
1095041975 12:37453454-37453476 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1095482738 12:42652542-42652564 CAACCCTGGCATCTTGATCTTGG + Intergenic
1095932842 12:47646499-47646521 TGCTACTGGCACCTTGATCTTGG - Intergenic
1096038167 12:48491208-48491230 ATCTGTTGGCACCTTGATCTAGG - Intronic
1098198091 12:68023714-68023736 CACTGCTGGCTCCTTGATCTTGG - Intergenic
1098719748 12:73881664-73881686 CCATACTGGCACCTTGATCTTGG + Intergenic
1098893233 12:76030899-76030921 CACCATCTGCAGCGTGATCTCGG + Exonic
1099338237 12:81392970-81392992 CACCATTGTCACCCTTGTCTGGG + Intronic
1099656341 12:85497119-85497141 CCCTGTTGGCACCTTGATCTTGG - Intergenic
1101309302 12:103561748-103561770 CACCATTGCCACCTGGCTCCTGG + Intergenic
1101385004 12:104249144-104249166 ATCTACTGGCACCTTGATCTTGG - Intronic
1101643345 12:106604866-106604888 CAGAATTGGCACATTGTTCTGGG + Intronic
1102231793 12:111267652-111267674 CCCTGTTGACACCTTGATCTTGG - Intronic
1102348582 12:112175407-112175429 CACTGCTGACACCTTGATCTGGG + Intronic
1102812005 12:115832556-115832578 ATCAACTGGCACCTTGATCTTGG - Intergenic
1102997719 12:117362554-117362576 CACACTTGGCACCTGGCTCTGGG + Intronic
1103225599 12:119284771-119284793 CATCCTTGGCACCTGGATCAGGG - Intergenic
1104147910 12:126053486-126053508 CACCATGGCCACCTTGTTCATGG - Intergenic
1104612958 12:130244500-130244522 CTCCAGTGGCACCTCAATCTTGG - Intergenic
1104935241 12:132360916-132360938 AACCAGTGACACCTTGATCGTGG + Intergenic
1106347644 13:28894462-28894484 ATCTACTGGCACCTTGATCTTGG + Intronic
1106607353 13:31241432-31241454 CACCACTGGCACCATGTTCATGG - Intronic
1106728011 13:32506105-32506127 CACTGCTGACACCTTGATCTTGG - Intronic
1106823989 13:33499371-33499393 CCACATTGGCACCTTGATGTTGG - Intergenic
1106844277 13:33720975-33720997 AAGAAGTGGCACCTTGATCTTGG - Intergenic
1106851223 13:33794816-33794838 TGCCACTGGCACCATGATCTTGG + Intergenic
1106871952 13:34031199-34031221 ACCCACTGGCACCTTGATCTTGG + Intergenic
1107121163 13:36797661-36797683 ATCTACTGGCACCTTGATCTTGG - Intergenic
1107265372 13:38546869-38546891 CACACTTGGCACCCAGATCTTGG + Intergenic
1107397448 13:40032566-40032588 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1108530132 13:51320789-51320811 CCCCATCCACACCTTGATCTTGG - Intergenic
1108606137 13:52040384-52040406 CTCTACTGGCACCTTGATCTTGG + Intronic
1108729639 13:53221082-53221104 CACTACTGGCACCTTGATTTTGG - Intergenic
1109894353 13:68664679-68664701 CTCCACTGACAACTTGATCTGGG - Intergenic
1110687704 13:78394976-78394998 CCCAGTTGACACCTTGATCTGGG - Intergenic
1111906352 13:94260410-94260432 CCCTACTGACACCTTGATCTTGG - Intronic
1112378133 13:98862871-98862893 CCCCACTGACACCTTGATTTTGG + Intronic
1112836897 13:103526533-103526555 CACTGCTGGCAGCTTGATCTTGG + Intergenic
1112869760 13:103955751-103955773 CTCTACTGGCACCTTGATCTTGG - Intergenic
1113058802 13:106299051-106299073 CCCCACTGACACCTTGATCTTGG + Intergenic
1114908824 14:27166496-27166518 CAATGTTGGCACCTTGATCCTGG - Intergenic
1115131829 14:30063002-30063024 CTCTGTTGACACCTTGATCTTGG + Intronic
1115166462 14:30453539-30453561 CTCTGGTGGCACCTTGATCTTGG - Intergenic
1115358928 14:32479831-32479853 ATCTACTGGCACCTTGATCTGGG + Intronic
1116777809 14:49201837-49201859 CCCTACTGACACCTTGATCTTGG + Intergenic
1117060558 14:51958323-51958345 CACATTTGGCATCTAGATCTTGG - Intronic
1117451712 14:55857616-55857638 CCCTACTGGCACCTTGATCGTGG - Intergenic
1117508796 14:56428227-56428249 CCCTTCTGGCACCTTGATCTTGG + Intergenic
1117816739 14:59606574-59606596 CCCTGCTGGCACCTTGATCTTGG + Intronic
1118126828 14:62914714-62914736 CATCACTGGTACCATGATCTTGG + Intronic
1118934895 14:70278678-70278700 ATCTACTGGCACCTTGATCTTGG + Intergenic
1119864359 14:77960979-77961001 CCCTAATGGCACCTTGGTCTTGG + Intergenic
1120841551 14:89089782-89089804 CCCTGTTGACACCTTGATCTTGG + Intergenic
1121066874 14:90975593-90975615 CCCTAGTGGCACATTGATCTTGG + Intronic
1121096773 14:91222854-91222876 AACTACTGGCACCTTGATGTTGG - Intronic
1121303562 14:92890593-92890615 ATCCACTGGCACCTTGATCTTGG + Intergenic
1121681855 14:95800034-95800056 ACCTACTGGCACCTTGATCTTGG + Intergenic
1121881203 14:97501756-97501778 ATCCGTTGTCACCTTGATCTTGG + Intergenic
1121883642 14:97523136-97523158 CACTGCCGGCACCTTGATCTTGG - Intergenic
1121946010 14:98122678-98122700 CCCTACCGGCACCTTGATCTTGG + Intergenic
1121955160 14:98206917-98206939 CACCATTGTCACTCTCATCTTGG + Intergenic
1122024680 14:98867210-98867232 CCCTACTGACACCTTGATCTTGG + Intergenic
1122368729 14:101215266-101215288 AATCACTGGCACCTTGATCTTGG + Intergenic
1122475749 14:102007843-102007865 CCCCGCTGGCACCTTGATCTTGG - Intronic
1122874424 14:104656997-104657019 CACTGGTGGCACCTTGATCTTGG + Intergenic
1123015454 14:105371842-105371864 GTCTACTGGCACCTTGATCTTGG - Intronic
1123587023 15:21769912-21769934 CACCATTGGCTCCTGGGTCCTGG + Intergenic
1123623661 15:22212477-22212499 CACCATTGGCTCCTGGGTCCTGG + Intergenic
1123785749 15:23671001-23671023 ACCCACTGACACCTTGATCTGGG + Intergenic
1124095439 15:26644571-26644593 CCCTGCTGGCACCTTGATCTGGG + Intronic
1124515245 15:30362334-30362356 CACCATCGGCATCCTGATGTCGG - Exonic
1124727677 15:32168395-32168417 CACCATCGGCATCCTGATGTCGG + Exonic
1125279020 15:38024948-38024970 ACCTACTGGCACCTTGATCTTGG + Intergenic
1125317485 15:38446705-38446727 ACCCACTGGCACCTTGATTTTGG - Intergenic
1125817209 15:42596333-42596355 CACCCTTTGCACCTTAAACTTGG + Intronic
1126292973 15:47102074-47102096 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1126468048 15:48978762-48978784 CAACGCTGGCACCTTGATCTTGG - Intergenic
1126522896 15:49616591-49616613 CACTGATGGCACCTTGGTCTTGG + Intronic
1126722734 15:51599312-51599334 CACAACTGGCATCTAGATCTTGG - Intronic
1126896905 15:53267893-53267915 CCCTATTGACACCTTGGTCTTGG - Intergenic
1127007460 15:54586354-54586376 GCCCACTGGCACCTTCATCTTGG - Intronic
1127484095 15:59403482-59403504 TCCCACTGGCACCTTGGTCTTGG + Intronic
1127521090 15:59743656-59743678 CACCGCTGGTCCCTTGATCTTGG + Intergenic
1127993870 15:64140904-64140926 CACATTTGGCACCCAGATCTTGG - Intronic
1128242550 15:66110850-66110872 CCCTCTTGGCACCTTGATCCTGG + Intronic
1128255698 15:66195071-66195093 TCCCATAGGCACCCTGATCTTGG - Intronic
1129025125 15:72564730-72564752 ATCTTTTGGCACCTTGATCTTGG - Intronic
1129654304 15:77513550-77513572 CCCGGTCGGCACCTTGATCTTGG - Intergenic
1132349396 15:101129596-101129618 CTCTGATGGCACCTTGATCTTGG + Intergenic
1133037974 16:3045488-3045510 CCCCTCAGGCACCTTGATCTTGG + Intergenic
1133133765 16:3694894-3694916 CCCTAGTGGCACCTTGATCTTGG - Intronic
1134185691 16:12083362-12083384 CCCTGCTGGCACCTTGATCTTGG - Intronic
1134215716 16:12315655-12315677 CCCTGCTGGCACCTTGATCTTGG + Intronic
1135087369 16:19486229-19486251 CCCCACCCGCACCTTGATCTTGG - Intronic
1135459534 16:22629318-22629340 CAACCCTGGCACCTTGATCATGG + Intergenic
1135970728 16:27070304-27070326 ATCCACTAGCACCTTGATCTTGG - Intergenic
1135974087 16:27095865-27095887 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1136384930 16:29918314-29918336 CATAATTGGCCCCTGGATCTAGG - Intronic
1137465797 16:48707754-48707776 CCTTACTGGCACCTTGATCTTGG + Intergenic
1137493814 16:48953461-48953483 CCCCACTGACACCTTGATCTTGG - Intergenic
1138088230 16:54153376-54153398 CCCCGTGGACACCTTGATCTTGG + Intergenic
1138344133 16:56309490-56309512 CACCCTTGGTTCCTTGGTCTTGG - Intronic
1138936685 16:61734926-61734948 CACCACTGAGACCTTGATTTTGG - Intronic
1139078868 16:63489905-63489927 CCCTACTGGCACCTTGATCTTGG - Intergenic
1139244136 16:65424414-65424436 TATCATAGGCACCTTGATTTTGG + Intergenic
1139604142 16:68005837-68005859 CAGCACTGGCTCCTGGATCTTGG - Intronic
1139991102 16:70939943-70939965 TTCTGTTGGCACCTTGATCTTGG + Intronic
1141363228 16:83417157-83417179 CACCACTGACTCTTTGATCTTGG - Intronic
1141551173 16:84807653-84807675 CCCCTTCGACACCTTGATCTTGG + Intergenic
1143782328 17:9235606-9235628 ATCTGTTGGCACCTTGATCTTGG - Intronic
1143868085 17:9938615-9938637 CCCTGCTGGCACCTTGATCTTGG + Intronic
1144010245 17:11141396-11141418 ATCCATTGGCACCATGATCTTGG - Intergenic
1144127876 17:12219873-12219895 CCCCACTGACACCTTGATTTTGG + Intergenic
1144152341 17:12461578-12461600 CCCTATTGGCACCTCGATCTTGG + Intergenic
1144274142 17:13648864-13648886 CCACACTGACACCTTGATCTTGG - Intergenic
1144647504 17:16985380-16985402 AAATGTTGGCACCTTGATCTTGG + Intergenic
1145023414 17:19449744-19449766 CCCCACCGACACCTTGATCTTGG + Intergenic
1147149544 17:38506534-38506556 CCACACTGGCACCTTGATCTTGG - Intronic
1148478381 17:47944106-47944128 CCCTGATGGCACCTTGATCTTGG - Intronic
1148957001 17:51362314-51362336 CCATGTTGGCACCTTGATCTTGG - Intergenic
1149115260 17:53086390-53086412 CACTGATGACACCTTGATCTTGG + Intergenic
1149388100 17:56162348-56162370 CCCTCTTGACACCTTGATCTTGG - Intronic
1149815719 17:59721905-59721927 CCCTGCTGGCACCTTGATCTTGG - Intronic
1150369005 17:64619616-64619638 CTCTGCTGGCACCTTGATCTTGG - Intronic
1150650855 17:67009187-67009209 CCCCATCAACACCTTGATCTTGG + Intronic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1150881177 17:69030254-69030276 ATCTATTGACACCTTGATCTTGG - Intronic
1151173213 17:72265861-72265883 CACTAATGGTACCTTTATCTCGG - Intergenic
1152082571 17:78197490-78197512 CCCTGCTGGCACCTTGATCTTGG + Intronic
1152225100 17:79089222-79089244 CACCATTGCCACCTGGCTGTAGG + Intergenic
1152987836 18:335652-335674 CACTGCTGACACCTTGATCTTGG + Intronic
1153450468 18:5221828-5221850 CTCTGATGGCACCTTGATCTTGG - Intergenic
1154039006 18:10835125-10835147 CTCTGTTGGCACCTCGATCTTGG + Intronic
1154272140 18:12929518-12929540 CCCTGCTGGCACCTTGATCTCGG - Intronic
1154367052 18:13720791-13720813 CCCTACTGACACCTTGATCTTGG - Intronic
1155198671 18:23498933-23498955 CGCTGCTGGCACCTTGATCTAGG - Intergenic
1155702660 18:28766873-28766895 CCATATTGGCACCATGATCTGGG + Intergenic
1156507048 18:37603841-37603863 ATCTACTGGCACCTTGATCTTGG + Intergenic
1157638226 18:49184002-49184024 CCCTACTGGCACTTTGATCTTGG + Intronic
1159592685 18:70352052-70352074 CCCTGCTGGCACCTTGATCTTGG + Exonic
1159599071 18:70411420-70411442 CAGCCCTGGCACCTTGATCTGGG + Intergenic
1159728116 18:71989190-71989212 AACTGCTGGCACCTTGATCTTGG + Intergenic
1160348000 18:78150798-78150820 CACCATCCACACCTTGATTTTGG + Intergenic
1160934201 19:1585434-1585456 CACAACTGGCCCCTAGATCTGGG + Intronic
1161863818 19:6819388-6819410 CCCTACTGACACCTTGATCTTGG + Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1163288828 19:16365468-16365490 CCCCACTGGCGCCTTGATCTTGG + Intronic
1163551334 19:17967674-17967696 CACCACTGGCCCCTGGATCCAGG + Intronic
1165334834 19:35162446-35162468 CCCTTCTGGCACCTTGATCTTGG - Intronic
1165341770 19:35217633-35217655 CACTTCTGGCACCTTGATCTTGG - Intergenic
1165571988 19:36783134-36783156 CACACTTGTCACCCTGATCTTGG + Intergenic
1165600100 19:37047446-37047468 TCCTAGTGGCACCTTGATCTTGG + Intronic
1167201545 19:48068875-48068897 CCCCACTGGCACCTTGATCTTGG + Intronic
1167786273 19:51639530-51639552 ATCCGCTGGCACCTTGATCTTGG - Intronic
1168170884 19:54588038-54588060 ACCCATTGGCACCTTGATTTGGG - Intronic
1168477520 19:56687616-56687638 CTCCTTCGACACCTTGATCTTGG - Intergenic
1168510892 19:56972893-56972915 AGCCACTGGCACCTCGATCTGGG - Intergenic
1202701495 1_KI270712v1_random:168461-168483 CAGCACTGGCACCCTGATCTTGG + Intergenic
1202707402 1_KI270713v1_random:33596-33618 CCACGTCGGCACCTTGATCTCGG - Intergenic
925729342 2:6906630-6906652 ACCAGTTGGCACCTTGATCTTGG - Intergenic
925980546 2:9173637-9173659 CCCTATTGACACCTTGATCTTGG - Intergenic
926097227 2:10089533-10089555 ATCTATTGGCGCCTTGATCTTGG + Intergenic
926224606 2:10958018-10958040 CTCTCCTGGCACCTTGATCTTGG + Intergenic
926352133 2:12005477-12005499 CCCTGCTGGCACCTTGATCTTGG - Intergenic
926357597 2:12055870-12055892 CACTGCTGGCACCTTGATTTTGG - Intergenic
926425072 2:12732707-12732729 CACCATTGGCACCATCATGCCGG - Intronic
926441649 2:12895358-12895380 CCCTGCTGGCACCTTGATCTTGG + Intergenic
926724998 2:15990801-15990823 ATCTACTGGCACCTTGATCTTGG + Intergenic
926977992 2:18534093-18534115 CACTGTCGACACCTTGATCTTGG - Intergenic
927446104 2:23162777-23162799 CACCAATGGCCCCTCGACCTTGG + Intergenic
928275475 2:29896581-29896603 CACCTGTGGCACCTTAACCTTGG + Intronic
929448086 2:42015901-42015923 ATCTGTTGGCACCTTGATCTTGG - Intergenic
929545368 2:42852033-42852055 CCCCGCTGGCACCTTGATCTTGG - Intergenic
930207410 2:48601993-48602015 ATCTATTGGCACCTTGATCTTGG - Intronic
930566169 2:53023166-53023188 TACCATTTGCACATTGACCTAGG + Intergenic
931105540 2:59051329-59051351 ATCCACTGGCACTTTGATCTTGG - Intergenic
931105724 2:59053192-59053214 ATGCACTGGCACCTTGATCTTGG - Intergenic
931128043 2:59299244-59299266 CTCTGCTGGCACCTTGATCTTGG + Intergenic
931226016 2:60332915-60332937 CCCTACTGGCACCTTGATCTTGG + Intergenic
931570585 2:63665224-63665246 CACTACTAACACCTTGATCTTGG - Intronic
931803754 2:65784638-65784660 AACTGCTGGCACCTTGATCTTGG - Intergenic
931926314 2:67076398-67076420 TACCATTGGCTCCTTGTTCAAGG - Intergenic
932261968 2:70334490-70334512 ATCTATTGGCACCTGGATCTTGG + Intergenic
933648561 2:84831274-84831296 TCCCGTTGACACCTTGATCTGGG + Intronic
934066494 2:88346661-88346683 CCCTGATGGCACCTTGATCTTGG - Intergenic
934172412 2:89551908-89551930 CAGCACTGGCACCCTGATCTTGG + Intergenic
934282725 2:91626260-91626282 CAGCACTGGCACCCTGATCTTGG + Intergenic
935063616 2:99629695-99629717 ATCCACTGGCACCTTGATCTTGG - Intronic
935194289 2:100802895-100802917 CCCTACTGGCACCCTGATCTTGG - Intergenic
935241548 2:101182812-101182834 CCCCGCTGGCACCTTGATCTTGG - Intronic
935247185 2:101229157-101229179 CCCCACTGGCACCTTAATCTTGG - Intronic
935716059 2:105939986-105940008 ATCAGTTGGCACCTTGATCTTGG - Intergenic
936235769 2:110741284-110741306 ACCCACTGACACCTTGATCTTGG - Intronic
936388040 2:112047923-112047945 CCCTAATGACACCTTGATCTAGG - Intergenic
936395654 2:112126566-112126588 ATCTACTGGCACCTTGATCTTGG + Intergenic
936396733 2:112137411-112137433 ATCTATTGACACCTTGATCTTGG + Intergenic
936415390 2:112304390-112304412 CCCTGCTGGCACCTTGATCTGGG - Intronic
936490880 2:112971100-112971122 AACTATTGACACCTTGATCTTGG + Intergenic
937145682 2:119642417-119642439 GTCTACTGGCACCTTGATCTCGG - Intronic
937332967 2:121043618-121043640 CCCTGCTGGCACCTTGATCTTGG + Intergenic
937901552 2:127023586-127023608 ATCCACTGGCAGCTTGATCTTGG - Intergenic
938152731 2:128901143-128901165 CCCCACTGGCACCTTGACCACGG + Intergenic
938208741 2:129446518-129446540 ATCTGTTGGCACCTTGATCTTGG - Intergenic
938566707 2:132525179-132525201 CCCCACTGTCACCTTGAGCTGGG + Intronic
938572761 2:132576008-132576030 ATCTCTTGGCACCTTGATCTTGG + Intronic
938912888 2:135901569-135901591 CACTGCTGGCACCCTGATCTTGG + Intergenic
939079844 2:137646687-137646709 CTTCACTGGCACCTTGATCTAGG + Intronic
939740224 2:145897436-145897458 ACCCACTGACACCTTGATCTTGG - Intergenic
939806347 2:146779292-146779314 CACCATGGCCACTTTGTTCTTGG - Intergenic
939899439 2:147833842-147833864 ATCTTTTGGCACCTTGATCTTGG + Intergenic
939955946 2:148527784-148527806 CCCCGATGACACCTTGATCTTGG + Intergenic
939993183 2:148895740-148895762 CAACCTTGGCACCTCGATCTTGG - Intronic
940491670 2:154369788-154369810 CTTCATTGACACCTTAATCTTGG - Intronic
940493798 2:154399382-154399404 ATCGGTTGGCACCTTGATCTTGG - Intronic
940543849 2:155057387-155057409 CAACATTGGCACCCTGATCCTGG - Intergenic
941151054 2:161916067-161916089 CCCTGTTGGCACCTTGATCTTGG + Intronic
941237629 2:162994966-162994988 CACTGCTGGCACCTTGATCTTGG + Intergenic
941957746 2:171221675-171221697 CCCTACTGGCACTTTGATCTTGG - Intronic
942068013 2:172290110-172290132 CCCTATTGACACGTTGATCTTGG - Intergenic
942322779 2:174750481-174750503 CTCTACTGGCACCTTGATCTTGG + Intronic
942413027 2:175731454-175731476 CCCTACTGTCACCTTGATCTTGG + Intergenic
942772496 2:179539152-179539174 CCATACTGGCACCTTGATCTTGG - Intronic
942942099 2:181630665-181630687 CCCCAATGGCACCTTGATTTTGG + Intronic
943186272 2:184611063-184611085 CCAAATTGGCACCTTAATCTTGG - Intronic
943954304 2:194167025-194167047 CCATACTGGCACCTTGATCTTGG + Intergenic
944062290 2:195582663-195582685 CCCCATTGGCACCCTGAAGTTGG - Intronic
944636465 2:201680320-201680342 ATCCACTGGCTCCTTGATCTTGG - Intronic
945372937 2:209043383-209043405 CCCCATCAGCACCTTGATTTTGG - Intergenic
946322542 2:218962055-218962077 CATCATTGGCACCTTGGACACGG - Exonic
946493330 2:220171120-220171142 CACCACTGACACCTTGATTTTGG + Intergenic
947260848 2:228220318-228220340 CCCTATAGACACCTTGATCTTGG + Intergenic
947617431 2:231567437-231567459 CCCTGCTGGCACCTTGATCTTGG + Intergenic
947923293 2:233898332-233898354 CTCTATTGACATCTTGATCTTGG - Intergenic
948106472 2:235418144-235418166 TACTACCGGCACCTTGATCTTGG + Intergenic
948157584 2:235796358-235796380 AACCATTGGCATATTGATCTGGG - Intronic
948238017 2:236404868-236404890 CAGAATCTGCACCTTGATCTAGG - Intronic
948636610 2:239342036-239342058 GTCCGCTGGCACCTTGATCTTGG + Intronic
948778879 2:240304868-240304890 CTCCTTTGGCCCCTGGATCTTGG - Intergenic
1169517911 20:6337755-6337777 CCCTATTGACACCTTGATTTTGG + Intergenic
1169938227 20:10908082-10908104 ATCCACTAGCACCTTGATCTTGG + Intergenic
1170974937 20:21153686-21153708 CCCTGTTGGCACCTTGATCTTGG - Intronic
1171515902 20:25734876-25734898 CACCAGTGGCAGGATGATCTGGG - Intergenic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1172213668 20:33218525-33218547 CCCTATTTGCATCTTGATCTTGG - Intronic
1172602602 20:36194341-36194363 TACCTTTAGCTCCTTGATCTTGG - Exonic
1173080312 20:39860954-39860976 CCCTATTGATACCTTGATCTTGG + Intergenic
1173290553 20:41711075-41711097 CAGCACTGGCACTTGGATCTTGG + Intergenic
1173526017 20:43733267-43733289 CCCTGCTGGCACCTTGATCTTGG + Intergenic
1173592503 20:44235885-44235907 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1174104483 20:48152713-48152735 CCCCACCGACACCTTGATCTGGG + Intergenic
1175250019 20:57603627-57603649 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1176128495 20:63486569-63486591 CCCCATCGACACCTTGATTTCGG + Intergenic
1176920589 21:14683453-14683475 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1176962011 21:15169683-15169705 ATCTACTGGCACCTTGATCTTGG - Intergenic
1177003978 21:15648105-15648127 AGCTACTGGCACCTTGATCTTGG + Intergenic
1177665551 21:24152711-24152733 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1177675204 21:24288827-24288849 CCATACTGGCACCTTGATCTTGG - Intergenic
1177703742 21:24673878-24673900 CCCTACTGGCACCTTGAACTCGG - Intergenic
1177730863 21:25025394-25025416 AACTTTTGACACCTTGATCTTGG - Intergenic
1178582501 21:33848372-33848394 CCCTGTTGTCACCTTGATCTTGG + Intronic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178807613 21:35852338-35852360 CCCTACTGGCACCTTGATCTTGG + Intronic
1179014238 21:37581605-37581627 CACTACAGACACCTTGATCTTGG + Intergenic
1179272451 21:39861871-39861893 CAGCCCTGGCACCTTGACCTTGG - Intergenic
1179462033 21:41542658-41542680 CCCCATTGGCATCTTGGTTTGGG + Intergenic
1181479593 22:23190030-23190052 CCCTGCTGGCACCTTGATCTTGG - Intronic
1181591269 22:23886443-23886465 ATCCACTGGCACCTTGATCTTGG - Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1181681383 22:24498062-24498084 CTGCTGTGGCACCTTGATCTTGG - Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1182246227 22:28959911-28959933 CCTCAGTGGCACCTTGATCTTGG + Intronic
1184134949 22:42542652-42542674 CCCTGCTGGCACCTTGATCTTGG - Intergenic
949128356 3:472522-472544 CTCCACTAGCATCTTGATCTTGG - Intergenic
949914815 3:8951846-8951868 CCATATTGGCACCTTGATCTTGG - Intronic
950131303 3:10548606-10548628 CACTGTGGGCACCTGGATCTGGG - Intronic
950697264 3:14712354-14712376 CCCTGTTGACACCTTGATCTTGG + Intronic
950703067 3:14763302-14763324 ATCCATTGGCGCCTTGGTCTTGG - Intronic
950835429 3:15914589-15914611 CCCTGCTGGCACCTTGATCTTGG + Intergenic
950948759 3:16977830-16977852 ATCTATTGGCACCTAGATCTTGG - Intronic
951466888 3:23010558-23010580 ATCCATTAGCAACTTGATCTTGG + Intergenic
951554208 3:23904308-23904330 ACCTACTGGCACCTTGATCTTGG - Intronic
951692004 3:25406418-25406440 CCCCACTGGCACCCTGATCTTGG - Intronic
952258432 3:31715399-31715421 CAGCATTGGCACCATGATGCTGG + Intronic
952690611 3:36200854-36200876 CCCTGATGGCACCTTGATCTTGG - Intergenic
953049860 3:39331274-39331296 CTGCATTGGCAGCTTGGTCTTGG - Intronic
953095948 3:39777364-39777386 CAACATTGGACCCTTGATCCTGG - Intergenic
953239609 3:41137128-41137150 AACAATTGGCACCTTGATCTTGG - Intergenic
953354679 3:42245584-42245606 CACTGTTGCCACCTTGGTCTGGG - Intergenic
953911781 3:46896844-46896866 CACCATTAGCACTTAGATTTGGG + Intronic
953936002 3:47043441-47043463 CACTGCTGACACCTTGATCTTGG + Intronic
954212587 3:49106428-49106450 CACCATGGGCACCTTTATGGTGG - Intergenic
955525959 3:59820023-59820045 ATCCGCTGGCACCTTGATCTTGG + Intronic
956457277 3:69434899-69434921 CTCTGTTGACACCTTGATCTTGG - Intronic
956521915 3:70113937-70113959 AGCAAATGGCACCTTGATCTTGG + Intergenic
956932736 3:74063913-74063935 CACTGCTGACACCTTGATCTTGG - Intergenic
956952649 3:74299783-74299805 CACCATTGGCACCACCACCTGGG + Intronic
957440198 3:80236449-80236471 CACTATTGACACCTTGATCCTGG - Intergenic
957608257 3:82432356-82432378 CACCACTGATGCCTTGATCTTGG - Intergenic
957713314 3:83892134-83892156 CTCTACTGGCACCTTGATCTTGG + Intergenic
958258899 3:91355911-91355933 CACCATTGCCACTTTGTTCATGG + Intergenic
958461263 3:94399480-94399502 TGCCAATGGCACCTTGATCTTGG - Intergenic
958910515 3:99988788-99988810 CACCATTGACCCATTGTTCTTGG + Intronic
959497911 3:107072831-107072853 CCCTGCTGGCACCTTGATCTTGG - Intergenic
959716512 3:109439331-109439353 AATCTTTGGCACCTTGATCTTGG + Intergenic
960252045 3:115466202-115466224 CACTGCTGACACCTTGATCTTGG + Intergenic
962956483 3:140271483-140271505 AAACGCTGGCACCTTGATCTTGG - Intronic
963564098 3:146906102-146906124 TACCATTGGCACCTTGATCTTGG - Intergenic
963654216 3:148024751-148024773 CCTTATTGACACCTTGATCTTGG + Intergenic
963905164 3:150767566-150767588 CACCTGTGGCACCTTGACCTTGG - Intergenic
964155074 3:153575502-153575524 ATCCCATGGCACCTTGATCTTGG - Intergenic
964276764 3:155017029-155017051 CCCTGCTGGCACCTTGATCTTGG - Intergenic
964277192 3:155021216-155021238 ATCCATAGGCACTTTGATCTTGG - Intergenic
964309622 3:155378851-155378873 ATCCGCTGGCACCTTGATCTTGG - Intronic
965148698 3:164942013-164942035 CACCTGTGGTACCTTGACCTCGG + Intergenic
965746313 3:171929483-171929505 AACTATGGGCACCTTGATCTTGG + Intronic
966082828 3:176025903-176025925 CCATATTGGCATCTTGATCTTGG - Intergenic
966380647 3:179341545-179341567 CCATACTGGCACCTTGATCTCGG + Intergenic
967850972 3:194082506-194082528 CCAAATTAGCACCTTGATCTGGG + Intergenic
969027330 4:4183948-4183970 CAGCACTGGCACCCTGATCTTGG - Intergenic
969110339 4:4840409-4840431 CCCCATCAGCACCTTGGTCTTGG - Intergenic
969266381 4:6066736-6066758 CTCCATTGGGACCTTCATCTTGG + Intronic
969288556 4:6223554-6223576 CCCTGCTGGCACCTTGATCTAGG - Intergenic
969383932 4:6830331-6830353 CCCCAGTGGCAACTTGATCCAGG + Intronic
969697374 4:8742234-8742256 CACCACTGTCACCCTGCTCTGGG + Intergenic
970367336 4:15373141-15373163 ACCTGTTGGCACCTTGATCTTGG - Intronic
970801742 4:19979984-19980006 CCCTACTGACACCTTGATCTGGG + Intergenic
970897480 4:21120326-21120348 CTCTACTGGCACCTTAATCTTGG - Intronic
971259913 4:25046723-25046745 CACCACTTGGATCTTGATCTTGG - Intergenic
971293755 4:25370762-25370784 CACCACTGCCACACTGATCTGGG - Intergenic
971310088 4:25518250-25518272 ATCAGTTGGCACCTTGATCTTGG - Intergenic
971527802 4:27643521-27643543 AATTATTGGCACCTCGATCTTGG - Intergenic
971853977 4:32020259-32020281 CACTGTTGACACCTTGATCTTGG - Intergenic
971895815 4:32592736-32592758 ACCCAATGGTACCTTGATCTTGG + Intergenic
972389413 4:38600703-38600725 CACTGTTGGCACCTTGACCTTGG - Intergenic
972456469 4:39260721-39260743 AATTACTGGCACCTTGATCTTGG - Intronic
973000583 4:44944175-44944197 GTCCATTGGCAGCCTGATCTTGG - Intergenic
973015294 4:45130196-45130218 CACCTTTGGCCACTGGATCTAGG + Intergenic
973242935 4:47977379-47977401 AACTGATGGCACCTTGATCTTGG + Intronic
973960052 4:56100762-56100784 CTCTGTTGGCACCTTGGTCTTGG + Intergenic
974030339 4:56770913-56770935 ATCCAATGGCACCTTGAACTCGG + Intergenic
974123243 4:57664953-57664975 CCCTACTGACACCTTGATCTTGG + Intergenic
974270821 4:59649749-59649771 AACAATTGACCCCTTGATCTTGG - Intergenic
974355886 4:60812252-60812274 CAAGATGGGCTCCTTGATCTTGG - Intergenic
974684388 4:65206508-65206530 ATCTACTGGCACCTTGATCTTGG - Intergenic
975531820 4:75407386-75407408 ATCTGTTGGCACCTTGATCTTGG - Intergenic
975937633 4:79600745-79600767 TCCCACTGGCATCTTGATCTTGG - Intergenic
976201949 4:82587787-82587809 TCCTGTTGGCACCTTGATCTTGG - Intergenic
976305207 4:83552990-83553012 CCCCACTGGCCCCCTGATCTTGG + Intronic
976635409 4:87282142-87282164 TATCATTGGCACCATGTTCTTGG + Intergenic
976660169 4:87532584-87532606 CCCTGCTGGCACCTTGATCTTGG - Intergenic
976803336 4:89018368-89018390 CACTGCTGGCACCTTGATCTTGG + Intronic
977265019 4:94843810-94843832 CACCTTTGCCTCCTTGATTTTGG + Intronic
977605332 4:98978905-98978927 ATCTGTTGGCACCTTGATCTTGG - Intergenic
977748478 4:100579968-100579990 ATCCACTGGTACCTTGATCTAGG + Intronic
977751606 4:100616388-100616410 CCCAACTGACACCTTGATCTTGG - Intronic
978769252 4:112436702-112436724 CCCCATTGGAACTTTGATCTTGG + Intronic
978795362 4:112703197-112703219 CCCTATTGTTACCTTGATCTTGG + Intergenic
979120191 4:116889196-116889218 GTCTGTTGGCACCTTGATCTTGG - Intergenic
979471375 4:121101451-121101473 ACCTACTGGCACCTTGATCTTGG + Intergenic
979704327 4:123703502-123703524 CCCTACTGGCACCTTGATCTTGG + Intergenic
979731213 4:124024653-124024675 ATCTGTTGGCACCTTGATCTTGG + Intergenic
979832784 4:125321073-125321095 CTCCATTAGCACCTTCATCTGGG - Exonic
980764660 4:137286208-137286230 CTCCGCTGACACCTTGATCTTGG - Intergenic
980910515 4:138989811-138989833 CCCCACTGACACTTTGATCTTGG + Intergenic
981028720 4:140102404-140102426 CTTGCTTGGCACCTTGATCTTGG - Intronic
981095448 4:140774814-140774836 CACTGCTGGCACCTTGATGTTGG - Intergenic
981299858 4:143174949-143174971 CGCTACTGGCATCTTGATCTTGG + Intergenic
981906463 4:149926666-149926688 CCACACTGGCACCCTGATCTTGG + Intergenic
982508455 4:156250480-156250502 AAACATTGACACCTTGATCTTGG - Intergenic
982677914 4:158397372-158397394 AACCATAGGCATTTTGATCTTGG + Intronic
982693693 4:158575678-158575700 CTCCACCAGCACCTTGATCTTGG + Intronic
983185184 4:164692395-164692417 CACCATGGCCACTTTGTTCTTGG - Intergenic
983228335 4:165106026-165106048 GGCTCTTGGCACCTTGATCTTGG + Intronic
983576194 4:169264190-169264212 CCCCACTGACACCTTGATCTTGG - Intronic
983582796 4:169325634-169325656 CACCATGGGCACTTTGTTCTTGG - Intergenic
983849136 4:172558576-172558598 CACTGTGGGCAACTTGATCTTGG + Intronic
984790264 4:183608649-183608671 CCACGTTGGCACCTTGATCTCGG + Intergenic
984966950 4:185148099-185148121 CCACAGTGTCACCTTGATCTTGG - Exonic
985130304 4:186732472-186732494 CACTGTGGGCACCTTGATCTTGG - Intergenic
985254720 4:188058383-188058405 GACAACTGGCACCTTGACCTTGG - Intergenic
986585697 5:9315015-9315037 CATCATTGCCTCCTTGGTCTTGG - Intronic
986620109 5:9663997-9664019 CACTATCGACACCTTGATTTTGG + Intronic
986809391 5:11339794-11339816 GTCTGTTGGCACCTTGATCTTGG + Intronic
986844606 5:11737891-11737913 GCCTACTGGCACCTTGATCTTGG + Intronic
986900853 5:12432014-12432036 CTCTTCTGGCACCTTGATCTTGG - Intergenic
987749354 5:22019639-22019661 CACTGATGGCACCTGGATCTTGG + Intronic
988098834 5:26653089-26653111 AACCAAAGGCACCTTGATATTGG - Intergenic
988205186 5:28124532-28124554 CACCATTGCCACTTTGTTCATGG + Intergenic
988300111 5:29412992-29413014 CAATGGTGGCACCTTGATCTTGG - Intergenic
988623855 5:32850238-32850260 GACCAGCAGCACCTTGATCTGGG + Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
988798962 5:34678624-34678646 CCCTGTTGACACCTTGATCTTGG + Intronic
989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG + Intergenic
989301468 5:39899141-39899163 ACCCTTTGGCACCTTTATCTTGG + Intergenic
989364533 5:40640732-40640754 CCCTGCTGGCACCTTGATCTTGG + Intergenic
989399652 5:40994958-40994980 ATCTACTGGCACCTTGATCTTGG + Intergenic
990543936 5:56803582-56803604 TACCACTGGCACCTTCACCTGGG - Intergenic
991025020 5:62019819-62019841 ATCTACTGGCACCTTGATCTTGG + Intergenic
991142352 5:63259451-63259473 ATCTATTGGCACTTTGATCTTGG + Intergenic
991288700 5:65009749-65009771 GACTGATGGCACCTTGATCTGGG + Intronic
991400458 5:66245886-66245908 CACTGCTGACACCTTGATCTTGG - Intergenic
992106664 5:73453602-73453624 CACCACTGGAACCTTGATTAAGG - Intergenic
992161509 5:74008571-74008593 CCCTGATGGCACCTTGATCTTGG - Intergenic
992200260 5:74376506-74376528 CAGGACTGGCACCTTGTTCTGGG + Intergenic
992615027 5:78539253-78539275 CACTGCTGGCACCTTGGTCTTGG + Intronic
992817659 5:80461565-80461587 CCCTGTTGGCACCTTGATCTTGG - Intronic
992903334 5:81320902-81320924 ATCTGTTGGCACCTTGATCTTGG - Intergenic
993434873 5:87880337-87880359 ATCTACTGGCACCTTGATCTTGG - Intergenic
993495874 5:88608261-88608283 CTCTGTTGGCACTTTGATCTAGG + Intergenic
993557292 5:89356366-89356388 ATCAGTTGGCACCTTGATCTTGG - Intergenic
994251796 5:97544347-97544369 CCCTATTGACACCTTGATCTTGG + Intergenic
994311523 5:98277957-98277979 CACAGCTGGCACCTTGATCTTGG - Intergenic
995427621 5:112042929-112042951 CACCATGGCCACTTTGATCATGG + Intergenic
995483079 5:112612154-112612176 CACTATTGGTAACTTGATATTGG + Intergenic
995805434 5:116047048-116047070 CTCAATTGGCACCTTGATCTTGG + Intronic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
997269052 5:132520263-132520285 CCTTACTGGCACCTTGATCTTGG + Intergenic
998071449 5:139200976-139200998 ATCTGTTGGCACCTTGATCTTGG + Intronic
998337191 5:141383576-141383598 CACCACTGTCACCTGGATGTGGG - Exonic
998652587 5:144138083-144138105 CAGCATTTTCACCTTGATTTAGG - Intergenic
999725332 5:154432238-154432260 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1000097654 5:157985775-157985797 CCCTGTTGGCACCTTGATCTTGG + Intergenic
1001296082 5:170500059-170500081 CCCTGCTGGCACCTTGATCTTGG - Intronic
1001697037 5:173678566-173678588 CCCCACCAGCACCTTGATCTTGG - Intergenic
1002343772 5:178534172-178534194 AGCCTGTGGCACCTTGATCTTGG - Intronic
1002598538 5:180340075-180340097 AATCTCTGGCACCTTGATCTTGG - Intronic
1003150430 6:3543328-3543350 CCCCCCTGACACCTTGATCTTGG - Intergenic
1003193024 6:3890786-3890808 ATCCACTGGCACTTTGATCTTGG - Intergenic
1003693826 6:8382032-8382054 AAACCCTGGCACCTTGATCTTGG - Intergenic
1003856972 6:10286423-10286445 CCCTACTGACACCTTGATCTTGG + Intergenic
1004160891 6:13211988-13212010 CCCTGTTGGCACCTTGATCTCGG - Intronic
1004300596 6:14454037-14454059 TCAAATTGGCACCTTGATCTTGG - Intergenic
1005106915 6:22233607-22233629 CTCCGTTGACACCTTGATCTGGG - Intergenic
1005634868 6:27743894-27743916 CAGCATTGGCTCCTTCAGCTGGG - Intergenic
1007008908 6:38395516-38395538 AATTGTTGGCACCTTGATCTTGG + Intronic
1007595936 6:43051285-43051307 GGCCATGGGCACCCTGATCTCGG - Exonic
1009281021 6:61751816-61751838 CACCTTTGACACCTTCATCTTGG - Intronic
1009878620 6:69537697-69537719 ATCTACTGGCACCTTGATCTTGG - Intergenic
1010273332 6:73939756-73939778 CACTGCTGACACCTTGATCTTGG + Intergenic
1010794249 6:80101002-80101024 TCCCACTGACACCTTGATCTTGG + Intergenic
1011705092 6:89993106-89993128 CCCTGGTGGCACCTTGATCTTGG + Intronic
1012087093 6:94841990-94842012 CCTTATTGGCACCGTGATCTTGG - Intergenic
1012180183 6:96143272-96143294 ATCTGTTGGCACCTTGATCTTGG + Intronic
1013066939 6:106693111-106693133 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1013370139 6:109462263-109462285 CCCCACTGACACGTTGATCTTGG + Intergenic
1013916275 6:115340941-115340963 CTCTACTGACACCTTGATCTTGG + Intergenic
1013986373 6:116198968-116198990 CACTATTGTCATCTTGAACTGGG + Intronic
1014143798 6:117973100-117973122 TGCCACTGACACCTTGATCTTGG - Intronic
1014254808 6:119150316-119150338 CACTACTGACACATTGATCTTGG + Intergenic
1014465091 6:121746346-121746368 CAGGAGTGGCCCCTTGATCTTGG + Intergenic
1014627063 6:123739416-123739438 ATCTATTGGCACCTTTATCTTGG + Intergenic
1015570247 6:134613535-134613557 CGACACTGGCACTTTGATCTTGG - Intergenic
1015706530 6:136094052-136094074 ACCTGTTGGCACCTTGATCTTGG - Intronic
1015727697 6:136316418-136316440 ATCAGTTGGCACCTTGATCTTGG + Intergenic
1016012650 6:139154433-139154455 CCCCATTGGAACTCTGATCTAGG + Intronic
1016030634 6:139333708-139333730 ATCTATTGGCACCTTGATCTTGG + Intergenic
1016652140 6:146474509-146474531 CCCTAATGGCACCTTGATCTTGG - Intergenic
1016724344 6:147344506-147344528 ACCCACTGACACCTTGATCTTGG - Intronic
1016791164 6:148068216-148068238 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1017084892 6:150704800-150704822 CCCCACTAGCACCTTGATCTTGG - Intronic
1017928284 6:158929589-158929611 GTCCACTGGCACCTTGATCTTGG - Intergenic
1018127026 6:160691668-160691690 AATAATTGGCACCTTGATCGGGG + Intergenic
1018674789 6:166209786-166209808 TCCTGTTGGCACCTTGATCTTGG + Intergenic
1018954052 6:168396110-168396132 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1020490766 7:8781115-8781137 ACCTATTGGCACCTTGATCTTGG + Intergenic
1021469508 7:20985381-20985403 CTCCACTGGCACCTCGATCTCGG - Intergenic
1021498884 7:21307510-21307532 CACTACTGACACCTTGATTTTGG - Intergenic
1021919216 7:25466804-25466826 ATCCATGAGCACCTTGATCTTGG + Intergenic
1022264834 7:28743683-28743705 CCCCACTGACACCTTGATCTTGG - Intronic
1022423823 7:30248569-30248591 CACCATTGACTCATTAATCTGGG - Intergenic
1022498757 7:30869494-30869516 ACCCTCTGGCACCTTGATCTTGG - Intronic
1022542541 7:31152163-31152185 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1022542591 7:31152650-31152672 CCCTGCTGGCACCTTGATCTTGG + Intergenic
1023082886 7:36542302-36542324 CCCCACGGACACCTTGATCTTGG + Intronic
1023752925 7:43388989-43389011 CATCACTGGCACCTTGGTCCAGG - Intronic
1023767129 7:43522080-43522102 ATCTTTTGGCACCTTGATCTTGG + Intronic
1024431563 7:49294335-49294357 CCCTGTTGGCACCTTGATCTTGG - Intergenic
1024640103 7:51321516-51321538 CCGCAGTGGCACCTTGATCATGG + Intergenic
1026975055 7:74492726-74492748 CACTGTCGGCACCTTGATTTTGG - Intronic
1027625008 7:80533736-80533758 ACCTACTGGCACCTTGATCTTGG + Intronic
1028145022 7:87311812-87311834 CCCTATTGACACCTTAATCTGGG + Intergenic
1028738855 7:94249265-94249287 CCCCGCTGACACCTTGATCTTGG + Intergenic
1028786924 7:94805681-94805703 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1028896441 7:96047038-96047060 ATCTACTGGCACCTTGATCTTGG - Intronic
1028978079 7:96936157-96936179 CCCCAACAGCACCTTGATCTTGG + Intergenic
1029036489 7:97527650-97527672 ATCAGTTGGCACCTTGATCTTGG + Intergenic
1029737046 7:102470690-102470712 CACCCTTGCCACCTTGTTCTGGG - Intronic
1030318066 7:108136691-108136713 CCCTGCTGGCACCTTGATCTTGG + Intergenic
1030452781 7:109733349-109733371 CCCTGATGGCACCTTGATCTAGG + Intergenic
1030956366 7:115857202-115857224 ACCCACCGGCACCTTGATCTTGG + Intergenic
1031035915 7:116787452-116787474 CACATGTGGCCCCTTGATCTTGG - Intronic
1031164844 7:118215495-118215517 AACTGCTGGCACCTTGATCTTGG - Intronic
1031285656 7:119863964-119863986 AACTACTGGCACTTTGATCTTGG + Intergenic
1032452037 7:132039992-132040014 CACCATTGGCATTTGGAGCTAGG - Intergenic
1033137977 7:138800558-138800580 AACCATCAACACCTTGATCTTGG - Intronic
1033734949 7:144213239-144213261 ATCTATTGGCATCTTGATCTTGG - Intergenic
1033748107 7:144337730-144337752 ATCTATTGGCATCTTGATCTTGG + Intergenic
1034079837 7:148266394-148266416 CACCATTGGCACTTTGTCCACGG + Intronic
1034204603 7:149304613-149304635 TACCACTGACACCTTGATCTTGG + Intergenic
1034252612 7:149704533-149704555 CCCCACTGACACCTTGATTTCGG - Intergenic
1034299722 7:150004926-150004948 GACCACTGCCACCTTGGTCTGGG - Intergenic
1034570539 7:151952325-151952347 CCCCACTGGCAGCTTAATCTTGG + Intergenic
1034786190 7:153928156-153928178 ATCTATTGGCACCTTGATCTTGG - Intronic
1034806328 7:154092377-154092399 GACCACTGCCACCTTGGTCTGGG + Intronic
1034821508 7:154220652-154220674 GACTGTTGGCACCTGGATCTTGG + Intronic
1035993286 8:4516285-4516307 CCCCACTGACACCGTGATCTTGG + Intronic
1036508505 8:9378925-9378947 CCCTCTTGACACCTTGATCTTGG - Intergenic
1036956447 8:13192866-13192888 CACTGCTGGCGCCTTGATCTTGG + Intronic
1037157639 8:15724208-15724230 TCCCATTGGCACCTTCATCTTGG + Intronic
1037407449 8:18558084-18558106 CTCTGCTGGCACCTTGATCTTGG + Intronic
1037553689 8:20001501-20001523 CACTGTTAACACCTTGATCTTGG - Intergenic
1037603695 8:20420126-20420148 CCTCGCTGGCACCTTGATCTTGG + Intergenic
1038007831 8:23448575-23448597 AACCTATGGCACCTTGATCGTGG + Intronic
1038277913 8:26137166-26137188 ATCCGCTGGCACCTTGATCTTGG + Intergenic
1038431992 8:27507772-27507794 CCCTGCTGGCACCTTGATCTTGG - Intronic
1038487377 8:27946500-27946522 CCCTGTTAGCACCTTGATCTTGG + Intronic
1039392537 8:37193062-37193084 ATCCACTGACACCTTGATCTTGG + Intergenic
1039558101 8:38491343-38491365 CCTCATCAGCACCTTGATCTTGG - Intergenic
1039631729 8:39120072-39120094 CCCTGTTGGCACCTTGATCTTGG + Intronic
1039750099 8:40470715-40470737 CCCCACTGACACCTTGATCTTGG + Intergenic
1040624169 8:49126515-49126537 CCCCACCGACACCTTGATCTTGG - Intergenic
1041077973 8:54186495-54186517 CACCCATGGCACCTTGATCTTGG + Intergenic
1041578875 8:59433684-59433706 CACCAATCCTACCTTGATCTTGG - Intergenic
1041931369 8:63291188-63291210 ATCCATTGACACCTTGATCTTGG - Intergenic
1041935420 8:63326824-63326846 CACCATTGCCACTTTGTTCATGG - Intergenic
1042053937 8:64742634-64742656 CCCTGTTGACACCTTGATCTTGG - Intronic
1042054014 8:64743520-64743542 CCCTGTTGACACCTTGATCTTGG - Intronic
1042191183 8:66188889-66188911 ATCCACTGGCAGCTTGATCTTGG + Intergenic
1042329172 8:67560012-67560034 ATCTGTTGGCACCTTGATCTTGG + Intronic
1042329446 8:67562787-67562809 ATCTGTTGGCACCTTGATCTTGG + Intronic
1042621738 8:70713955-70713977 CCCTATTGGCACCTTGATCTTGG - Intronic
1042850500 8:73211689-73211711 GTCTGTTGGCACCTTGATCTTGG + Intergenic
1043382243 8:79715430-79715452 GTCTACTGGCACCTTGATCTTGG - Intergenic
1043607764 8:82023550-82023572 AACCATTGACTCCTTAATCTTGG + Intergenic
1043761125 8:84069680-84069702 AACTAATGGCATCTTGATCTTGG - Intergenic
1044199518 8:89416895-89416917 CATTACTGGCACCATGATCTTGG + Intergenic
1044300795 8:90580792-90580814 CACCAGTGGGACCTTGACCCCGG - Intergenic
1044827128 8:96209279-96209301 CACTGTCGCCACCTTGATCTTGG - Intergenic
1045238311 8:100375575-100375597 CACCTGTGGGACCTTGACCTTGG + Intronic
1045366982 8:101485434-101485456 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1045748356 8:105451710-105451732 TGCCGTTGACACCTTGATCTTGG + Intronic
1046097953 8:109582671-109582693 CACCATCATCACCATGATCTAGG + Intronic
1046418688 8:113949228-113949250 AGCTACTGGCACCTTGATCTTGG + Intergenic
1046509300 8:115179708-115179730 CAACACTGGCACCTTAATCTTGG - Intergenic
1046512806 8:115220803-115220825 GACCGCTGGCACCTTAATCTTGG - Intergenic
1046814527 8:118569748-118569770 CTCAGCTGGCACCTTGATCTTGG + Intronic
1046886203 8:119369925-119369947 CAAAACTGGCACCTTGATCTTGG + Intergenic
1048150291 8:131887219-131887241 CCCTGTTGACACCTTGATCTTGG - Intergenic
1048195058 8:132325664-132325686 CCCTGTTGACACCTTGATCTTGG + Intronic
1048243680 8:132769722-132769744 ATCAATTGGCACCTTGATCTTGG + Intergenic
1048393913 8:133994787-133994809 CCCTGTTGACACCTTGATCTTGG + Intergenic
1048398984 8:134045666-134045688 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1048932686 8:139327408-139327430 CCCTATTGGTACCTTGATCTTGG + Intergenic
1049153522 8:141052369-141052391 ATCCACTGGCACCTTGATCTTGG + Intergenic
1050114080 9:2244963-2244985 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1050327487 9:4511251-4511273 ATCTAATGGCACCTTGATCTTGG - Intronic
1054865703 9:69998955-69998977 CAGCAATGGCTCCATGATCTTGG - Intergenic
1055141955 9:72886582-72886604 CAGCATGGGCACCTTGAGCCTGG - Intergenic
1055898966 9:81212676-81212698 CAGGATTGGCACTTTGAGCTGGG + Intergenic
1055928185 9:81532306-81532328 CCCTATTGGCACCTTGATCTTGG - Intergenic
1057403840 9:94749436-94749458 CACAACTGGCACCTAGATCTTGG - Intronic
1057430098 9:94986120-94986142 CGCTGTTGGCACCTTGGTCTTGG - Intronic
1057640220 9:96812496-96812518 CACATGTGGCCCCTTGATCTTGG - Intergenic
1058216977 9:102246698-102246720 ACCCAGTGACACCTTGATCTTGG - Intergenic
1058259150 9:102808866-102808888 CACCATGGGCACTTTGTTCATGG + Intergenic
1059358106 9:113717027-113717049 ATCCACTGGCACCTTGATTTTGG + Intergenic
1059472308 9:114514933-114514955 CCCTGTTGACACCTTGATCTTGG - Intergenic
1059771459 9:117430541-117430563 CCCAGATGGCACCTTGATCTTGG - Intergenic
1059872574 9:118594405-118594427 ATCTGTTGGCACCTTGATCTTGG - Intergenic
1060001824 9:119965719-119965741 CCCCACAGGCACCTTGATTTTGG + Intergenic
1061254431 9:129445985-129446007 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1061303313 9:129718609-129718631 CTCCACTGGGACCTTGAACTTGG + Intronic
1061319772 9:129821250-129821272 CACCATCTGGATCTTGATCTCGG - Intronic
1185895671 X:3856444-3856466 CACAATGTGTACCTTGATCTAGG + Intergenic
1185900790 X:3894868-3894890 CACAATGTGTACCTTGATCTAGG + Intergenic
1185905905 X:3933307-3933329 CACAATGTGTACCTTGATCTAGG + Intergenic
1186058972 X:5682935-5682957 CGCTACTGGCACCTTGCTCTTGG + Intergenic
1186606415 X:11097653-11097675 AACCACTTGCACCTTGATCTTGG - Intergenic
1186963450 X:14762057-14762079 ACCTACTGGCACCTTGATCTTGG - Intergenic
1187582296 X:20621073-20621095 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1188070235 X:25709351-25709373 AACAGCTGGCACCTTGATCTTGG + Intergenic
1188113760 X:26220497-26220519 CCCTGCTGGCACCTTGATCTTGG - Intergenic
1188547070 X:31319638-31319660 AACCATTGGTATCTTCATCTGGG + Intronic
1189302743 X:39964344-39964366 CCCTACTGACACCTTGATCTTGG - Intergenic
1189339132 X:40191280-40191302 CTCTGTTGACACCTTGATCTTGG + Intergenic
1190383827 X:49865132-49865154 ACCTATTGGCACCTTGATCTTGG + Intergenic
1191737180 X:64399177-64399199 ACCTACTGGCACCTTGATCTTGG - Intergenic
1191752349 X:64556518-64556540 AACGGTTGGCACCTTGATCTTGG + Intergenic
1191997880 X:67115907-67115929 CCCTATTGACACCTTGATTTTGG - Intergenic
1192305152 X:69951334-69951356 ACCTGTTGGCACCTTGATCTTGG + Intronic
1194690516 X:96978957-96978979 CACCCTTGGTTCCTTGATCATGG + Intronic
1194797339 X:98228000-98228022 AACCATTTGCACCTTGAAATAGG + Intergenic
1195145882 X:102017010-102017032 GAACATTAGTACCTTGATCTTGG + Intergenic
1195253847 X:103074737-103074759 CTCTACTGGCACCTTGATTTTGG + Intergenic
1195571030 X:106399012-106399034 TACTGCTGGCACCTTGATCTGGG - Intergenic
1195612831 X:106888269-106888291 CACTACTGACACCTTGATCTTGG + Intronic
1195760733 X:108243511-108243533 CCACACTGGCACCCTGATCTTGG + Intronic
1195866707 X:109440145-109440167 ACCTGTTGGCACCTTGATCTTGG - Intronic
1195973335 X:110498117-110498139 CACCACCGGCACCTTGATCTTGG - Intergenic
1195977801 X:110546517-110546539 CCCTGATGGCACCTTGATCTTGG + Intergenic
1196021735 X:110997939-110997961 CACCACCAGCACCTTGATCTTGG + Intronic
1196315100 X:114213191-114213213 CTGTGTTGGCACCTTGATCTTGG - Intergenic
1197029118 X:121792320-121792342 CCCCACTGACACCTTGATTTTGG - Intergenic
1198166658 X:134064340-134064362 ACCCACTGGTACCTTGATCTTGG + Intergenic
1198287634 X:135207550-135207572 CACCATTTAGACCTTGATATTGG + Intergenic
1198670262 X:139072385-139072407 CTCTGATGGCACCTTGATCTTGG + Intronic
1199194698 X:145014349-145014371 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1201673780 Y:16556379-16556401 CCCTGCTGGCACCTTGATCTTGG + Intergenic