ID: 1088618114

View in Genome Browser
Species Human (GRCh38)
Location 11:111653737-111653759
Sequence GTGCTGGCACTGAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 340}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088618114_1088618125 23 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618125 11:111653783-111653805 AGGATTGCCCTGGGGCAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 196
1088618114_1088618127 27 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618127 11:111653787-111653809 TTGCCCTGGGGCAAGCTGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 276
1088618114_1088618123 14 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618123 11:111653774-111653796 CATAATTTTAGGATTGCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1088618114_1088618124 15 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618124 11:111653775-111653797 ATAATTTTAGGATTGCCCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 129
1088618114_1088618118 3 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618118 11:111653763-111653785 AATGTTCCACCCATAATTTTAGG 0: 1
1: 0
2: 2
3: 22
4: 182
1088618114_1088618126 24 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618126 11:111653784-111653806 GGATTGCCCTGGGGCAAGCTGGG 0: 1
1: 0
2: 2
3: 61
4: 1649
1088618114_1088618122 13 Left 1088618114 11:111653737-111653759 CCATCCATTTTCAGTGCCAGCAC 0: 1
1: 0
2: 1
3: 51
4: 340
Right 1088618122 11:111653773-111653795 CCATAATTTTAGGATTGCCCTGG 0: 1
1: 0
2: 2
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088618114 Original CRISPR GTGCTGGCACTGAAAATGGA TGG (reversed) Intronic
900566915 1:3337827-3337849 GTGCTGGAACAAAAGATGGAGGG + Intronic
900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG + Intronic
900721300 1:4177519-4177541 GAGCTGGGCCTGAGAATGGAGGG - Intergenic
900793232 1:4692882-4692904 GTGCTGGAACTGGACAGGGAAGG + Intronic
900868702 1:5286780-5286802 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
901185108 1:7367934-7367956 GTGCAGGCACTGGGCATGGATGG + Intronic
901185168 1:7368222-7368244 GTGCAGGCACTGGGCATGGATGG + Intronic
901758344 1:11455016-11455038 TTGCTGGCTTTGAACATGGAAGG - Intergenic
902878540 1:19355632-19355654 CTGCTGGAACTGAGAACGGAAGG + Intronic
903174543 1:21573123-21573145 GTGGTGGGAATGAAAATGAAAGG + Intronic
903818223 1:26081124-26081146 GTACAGGCATAGAAAATGGATGG + Intergenic
904374776 1:30073518-30073540 GTGCAGGCTCTGAGACTGGAAGG + Intergenic
905697009 1:39981966-39981988 CTGATGGCAGTGAAAAGGGAGGG - Intergenic
908122954 1:61003022-61003044 GTGCTGTCTCTGACCATGGACGG - Intronic
908345346 1:63226795-63226817 GTACTGGCAGTGAAAATGCCAGG - Intergenic
909001208 1:70219781-70219803 GTGCTTATACAGAAAATGGATGG - Intronic
911369042 1:96974378-96974400 GAGCTTGCAATCAAAATGGAAGG - Intergenic
911488474 1:98532077-98532099 GTGCTGTCACAGATAAAGGATGG - Intergenic
913403386 1:118461608-118461630 GTGCAGGCACTGAACCTGGAAGG + Intergenic
915106747 1:153539616-153539638 GTGCTGGCACTCAAACTGAAAGG - Intronic
915275339 1:154784439-154784461 GTGCTTGTACAGAAGATGGAAGG - Intronic
916373911 1:164130569-164130591 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
916378256 1:164179813-164179835 TTGCTGGCTTTGAAAATGAAAGG - Intergenic
917869166 1:179227026-179227048 GTGGTGGCAGTGGAAATGGGAGG - Intronic
917947986 1:179996569-179996591 TGGCTGGAACTGAAATTGGAAGG - Exonic
918163854 1:181925714-181925736 GTGCTGCCAGTGAAAAAGAAAGG - Intergenic
918270844 1:182897683-182897705 TTGCTGGCTTTGAAAATGGATGG + Intergenic
918532140 1:185535216-185535238 GAGCTGTCAAGGAAAATGGAAGG - Intergenic
918727510 1:187944236-187944258 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
920258904 1:204675512-204675534 GTGCTGGTGTTGAAGATGGAAGG - Intronic
921493437 1:215807129-215807151 TTGCTGGCCTGGAAAATGGAAGG + Intronic
921707427 1:218340064-218340086 GTACTGGCACTAAAATGGGAAGG + Intergenic
922370682 1:224907611-224907633 TTGCTGGCTTTGAAAATGTAAGG - Intronic
922665364 1:227464462-227464484 GGGCTGGCACAGAAAGTTGACGG + Intergenic
923323648 1:232860908-232860930 TTGCTCGCACTGAGCATGGATGG - Intergenic
923394473 1:233547365-233547387 GTGCTTGCATTGAAATTTGAAGG - Intergenic
1063171079 10:3510539-3510561 CTGCTAGCTCTGAAGATGGAAGG + Intergenic
1064117939 10:12594975-12594997 GTGCTGACACTGACAATGAAAGG + Intronic
1065535674 10:26712779-26712801 CTCTTGGCACTGAACATGGATGG - Intronic
1066138121 10:32472521-32472543 GCTCTGGCACAGAAAATTGAAGG + Exonic
1066193545 10:33077518-33077540 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1067787994 10:49264919-49264941 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1067992527 10:51231070-51231092 TTGCTGGGAGTGAAAAGGGAGGG + Intronic
1068385879 10:56326950-56326972 TTGCTGGCAGTGGAAATGGATGG - Intergenic
1068517602 10:58043813-58043835 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1072449867 10:95531358-95531380 CTGTTGGCTTTGAAAATGGAAGG - Intronic
1072952251 10:99858006-99858028 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1073612526 10:104958585-104958607 CTGCTGGCTTTGAAGATGGAAGG + Intronic
1074666608 10:115733894-115733916 GTTCTGGCACTGAATATTTATGG - Intronic
1074845125 10:117391009-117391031 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1075680357 10:124326821-124326843 GTGTTGGCACTGGAAGGGGAAGG - Intergenic
1075961125 10:126568441-126568463 GTGCTGGCTTTGAAGACGGAGGG - Intronic
1076245987 10:128948266-128948288 GAGCTTGCACTAAAAAGGGAAGG + Intergenic
1076591483 10:131586776-131586798 GAGGTACCACTGAAAATGGAAGG + Intergenic
1076612555 10:131735799-131735821 GTGCTGGCTTTGAGGATGGAGGG + Intergenic
1077736161 11:4793836-4793858 GTGATGGTATTGAACATGGAAGG + Intronic
1077928100 11:6702543-6702565 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1077935898 11:6785341-6785363 TTCCTGGCACTGACAATGGGTGG + Exonic
1079618112 11:22520005-22520027 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1080050066 11:27850679-27850701 TTGCTGGCTCTGAAGGTGGATGG - Intergenic
1080077525 11:28168852-28168874 ATGCTGACACTGAAAACAGAGGG + Intronic
1080323648 11:31044523-31044545 CTGCTAGCTCTGAAGATGGAAGG + Intronic
1081240169 11:40695713-40695735 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1081759027 11:45564215-45564237 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1082278575 11:50246675-50246697 GAGCTGGCACGGAAGCTGGAGGG + Intergenic
1083048135 11:59754919-59754941 CTGCTGGCAGTGAAAGTGGGGGG - Intronic
1083580415 11:63821238-63821260 CTGCTGGCTTTGAAGATGGAAGG - Intronic
1087518745 11:99201737-99201759 CTGCTGACTCTGAAGATGGAAGG + Intronic
1088618114 11:111653737-111653759 GTGCTGGCACTGAAAATGGATGG - Intronic
1089601686 11:119619668-119619690 GAGCTTGCAGTGAAATTGGAGGG - Intergenic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1090859577 11:130640852-130640874 CTGCTGGCACTGGAAATGCCGGG - Intergenic
1090883255 11:130853323-130853345 GTGCTGGCAATGAAAAGGTCTGG - Intergenic
1093323227 12:17739894-17739916 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1095393893 12:41741407-41741429 GTGCTGGCTTTGAAGGTGGAGGG - Intergenic
1095893705 12:47259121-47259143 TTGCTGGCTTTGAAAATGAAAGG - Intergenic
1096113354 12:49041384-49041406 GGGCTGCCAATGAAAATGGTGGG + Exonic
1097726531 12:63081417-63081439 GTCCTGGCACTGAGAAAGGTGGG + Intergenic
1099061889 12:77921781-77921803 ATGGTGCCACTGAAAATGTATGG + Intronic
1099387977 12:82041185-82041207 GTGATGGTACAGAAAATGAAAGG - Intergenic
1101339195 12:103826482-103826504 TTGCTGGCTTTGAAAATGCAAGG + Intronic
1103884983 12:124193638-124193660 GTGGTGGAAATGAAAAAGGAAGG + Intronic
1104064002 12:125291469-125291491 ATGCTGGCTCTGAAGATGGAGGG + Intronic
1104222272 12:126796539-126796561 CTGCTGGCTTTGAAAATAGAGGG - Intergenic
1104522010 12:129485064-129485086 GTGCAAGCACTGAATTTGGAAGG + Intronic
1104557770 12:129817510-129817532 GTTCTCAGACTGAAAATGGAAGG - Intronic
1106858562 13:33879912-33879934 TGGCTGGCTCTGAAGATGGAAGG - Intronic
1106909022 13:34443129-34443151 ATGTTGGCACCGACAATGGATGG + Intergenic
1107219676 13:37967501-37967523 GTGCTGGCTGTGAAGATGTAAGG - Intergenic
1107539144 13:41369729-41369751 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1107619105 13:42206684-42206706 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1108077336 13:46694922-46694944 GTGCTGTCACCCAAAAGGGAAGG - Exonic
1108317833 13:49255170-49255192 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1110308158 13:74014680-74014702 GCGAAGGCACTGAAAATAGAAGG - Intronic
1112800503 13:103104549-103104571 GTGCTGGCTTTGCAAATGAAAGG - Intergenic
1112919971 13:104600490-104600512 TTACTGGCATTGAAAATGAATGG - Intergenic
1114345914 14:21794902-21794924 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1114446146 14:22789816-22789838 CTGCTGACTTTGAAAATGGAAGG + Intronic
1114688544 14:24558529-24558551 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1114834868 14:26192083-26192105 ATGCTATCACTGAAAATGAAAGG + Intergenic
1117420516 14:55540309-55540331 TTGCTGGCTCTGAAGATGAAGGG + Intergenic
1118027216 14:61781636-61781658 TTGACGGCAGTGAAAATGGAGGG - Intronic
1121076538 14:91073654-91073676 TTGCTGGCTTTGAAAATGGAGGG + Intronic
1124169204 15:27357736-27357758 GAGCTGGATATGAAAATGGATGG + Intronic
1124713594 15:32035532-32035554 GTTTTGGCACTGAAGATGGCAGG + Intronic
1125933545 15:43616441-43616463 GTGCTGGCAGAGCAAGTGGATGG + Exonic
1125946643 15:43715903-43715925 GTGCTGGCAGAGCAAGTGGATGG + Intergenic
1126371685 15:47953773-47953795 TTGCTGGCTTTGAAAATGGAAGG - Intergenic
1126413821 15:48397714-48397736 GTGGTGGCTCAGAAAGTGGAAGG - Intergenic
1126664372 15:51062980-51063002 TGGCTGGCTCTGAAGATGGATGG + Intronic
1128304751 15:66590876-66590898 TTGCTGGCCTTGAAGATGGAGGG - Intronic
1129128531 15:73467959-73467981 TTGCTGGCATTGAGGATGGAAGG - Intronic
1129855098 15:78818243-78818265 GAGCTGGCCTTGAAAATGTATGG + Intronic
1130058747 15:80554029-80554051 ATGCTGACACTGGCAATGGAGGG - Intronic
1130959673 15:88651518-88651540 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1131119987 15:89815976-89815998 CTGCTGGCTTTGAAGATGGATGG - Intergenic
1131198691 15:90378337-90378359 TTGCTGGTATTGAATATGGAGGG - Intergenic
1131723068 15:95192355-95192377 GTCCTAGCACTGAATCTGGATGG - Intergenic
1132278823 15:100594716-100594738 GAGTTGGCACTGAACATGTATGG - Intronic
1133400244 16:5480488-5480510 CTGCTGCCGCTGAAAATGCACGG + Intergenic
1134042713 16:11080728-11080750 CTGCTGGCTTTGAGAATGGAGGG - Intronic
1134044536 16:11091526-11091548 GGGCTGGCACTGCACAGGGAAGG + Intronic
1134073989 16:11277744-11277766 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1135206596 16:20490235-20490257 GTAGTGGCACTGAAGCTGGAGGG - Intergenic
1135212290 16:20533397-20533419 GTAGTGGCACTGAAGCTGGAGGG + Intergenic
1136012160 16:27370858-27370880 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1138020022 16:53470383-53470405 GTATTGCCAATGAAAATGGAGGG + Exonic
1138239515 16:55415788-55415810 GTGGTGGGGGTGAAAATGGAGGG + Intronic
1138767223 16:59618718-59618740 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1138888741 16:61114871-61114893 TTGCTGGCCTTGAAGATGGAAGG + Intergenic
1139135320 16:64196688-64196710 GTGGTGGTAATGGAAATGGAGGG + Intergenic
1140783670 16:78319150-78319172 TTGCTGGCTTTGAAAATGGAGGG + Intronic
1140986891 16:80166376-80166398 ATGCTGGCTTTGAAGATGGAGGG + Intergenic
1141861528 16:86719840-86719862 GGCCTGGCACTGAAAATGCTTGG + Intergenic
1143304525 17:5935615-5935637 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1146173707 17:30651403-30651425 TTGCTGGCTTTGAAAATGGAGGG - Intergenic
1146347161 17:32067424-32067446 TTGCTGGCTTTGAAAATGGAGGG - Intergenic
1146424350 17:32722473-32722495 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1147394313 17:40129777-40129799 GTGCAGGCATTGCAAATAGATGG + Intronic
1147944484 17:44072940-44072962 GTGCTCACACAGAAAATGAACGG - Intronic
1149337315 17:55649340-55649362 TTACTGGCTCTAAAAATGGAAGG - Intergenic
1149459131 17:56813018-56813040 ATGCTGGCACAGAAAATGTCAGG + Intronic
1150250906 17:63704033-63704055 GTGCTGGCACTGGGCCTGGAGGG + Exonic
1152043949 17:77923760-77923782 TGGCTGGCCCTGCAAATGGAGGG + Intergenic
1153312124 18:3687013-3687035 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1153399301 18:4666269-4666291 GAGAAAGCACTGAAAATGGATGG + Intergenic
1153495480 18:5694002-5694024 GTGGTGGCAGTGAACAGGGAAGG - Intergenic
1153545982 18:6205215-6205237 CTGCTGGCTTTGAATATGGATGG + Intronic
1155799317 18:30081455-30081477 TTGCTGGCAGTGATAATGGAAGG + Intergenic
1156060027 18:33063205-33063227 GTGTTGGCACTGGCAATGGCAGG - Intronic
1156259692 18:35433429-35433451 GGGCTGGCTCTGCAAGTGGAAGG - Intergenic
1157297246 18:46455273-46455295 CTGCTGGGCCTGAAAGTGGAGGG + Intronic
1159371334 18:67530965-67530987 TTGATGGCAGTGAAGATGGATGG + Intergenic
1160600232 18:80006965-80006987 GTGATGACAAAGAAAATGGAAGG + Intronic
1161169741 19:2806853-2806875 GTGCTGGCCCTGGAGGTGGAGGG + Intronic
1161458514 19:4382144-4382166 CTGCTAGCTCTGACAATGGAGGG - Intronic
1161656056 19:5515667-5515689 GTGCTGTTCCTGAAAAAGGAAGG + Intergenic
1162988711 19:14288637-14288659 TTGCTGGCTTTGAAAATGGAGGG + Intergenic
1164764194 19:30751154-30751176 ATGCTGGGAATGAAAAAGGATGG - Intergenic
1165661643 19:37585913-37585935 TTGCTGGCTTTGAAAATGGATGG + Intronic
1166398398 19:42459547-42459569 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1167136057 19:47616327-47616349 GTGTTGGCATTTTAAATGGAAGG + Intronic
1167625938 19:50589257-50589279 CTGCTGACTTTGAAAATGGAAGG + Intergenic
925324786 2:3009926-3009948 TTGCTGGCACTGACAAGGGAGGG - Intergenic
925517636 2:4701982-4702004 GTGTTGGCATTGAAACTTGAAGG - Intergenic
926823102 2:16875296-16875318 GGGCTGTCACTGAATAAGGATGG - Intergenic
927228518 2:20796117-20796139 GTGAAGACACTGAGAATGGAGGG - Intronic
927897981 2:26797480-26797502 TTGCTGGCATTGAAGATGGAGGG + Intronic
927911978 2:26906089-26906111 TTGCTGGCTTTGAAGATGGAAGG - Intronic
928679112 2:33680794-33680816 GTGATGGGAATGGAAATGGAGGG + Intergenic
929191242 2:39142084-39142106 TGGATGGCACTGAAAATGAATGG + Intergenic
932697815 2:73971223-73971245 CTGCTGGCACTGAAACTGAAGGG - Intergenic
932829472 2:74975110-74975132 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
933301309 2:80544314-80544336 CTGTTGGCTTTGAAAATGGAAGG + Intronic
933319963 2:80760989-80761011 ATGCTTCCACTGCAAATGGAAGG - Intergenic
933647991 2:84827813-84827835 TTGCTGGCTTTGAAGATGGAAGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934615958 2:95771207-95771229 TTGCTGGCTTTGGAAATGGAAGG - Intergenic
934644938 2:96053355-96053377 TTGCTGGCTTTGGAAATGGAAGG + Intergenic
934838345 2:97609444-97609466 TTGCTGGCTTTGGAAATGGAAGG + Intergenic
935270337 2:101428799-101428821 GTGGTGGCACTGAACATTCATGG + Intronic
935386890 2:102509259-102509281 TTGCAGGCTCTGAAGATGGAAGG - Intronic
936046838 2:109195016-109195038 GTGGGGGAAATGAAAATGGAAGG + Intronic
939805174 2:146766881-146766903 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
940058878 2:149542940-149542962 TTGCTGGCTCTGAAGAGGGAAGG - Intergenic
940128651 2:150356115-150356137 GTACTAGAATTGAAAATGGAAGG - Intergenic
940310890 2:152278050-152278072 TTGCTGGCACTGGCAATGGCAGG - Intergenic
940644847 2:156380589-156380611 TTGCTGGCTTTGAAACTGGAGGG - Intergenic
940644923 2:156381250-156381272 TGGCTGGAATTGAAAATGGAAGG - Intergenic
941114100 2:161451745-161451767 TTGCTGGCTTTGAAGATGGAAGG + Intronic
941320828 2:164052136-164052158 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
941928337 2:170917350-170917372 GTGCTGGCACTTGGAATGGCTGG - Intergenic
943206663 2:184906905-184906927 GTGCTGGCTTTGAAGATGGAAGG + Intronic
946611091 2:221458801-221458823 CTGCTGACACTGACAATGGCTGG + Intronic
947094332 2:226548982-226549004 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
947408599 2:229808953-229808975 GTGCTGACACTGTGAGTGGAGGG + Intronic
947740824 2:232484119-232484141 GAGCTGGCACAGGAGATGGAGGG - Exonic
947743374 2:232495224-232495246 TTGCTGGCTGTGGAAATGGAGGG - Intergenic
1170142907 20:13142854-13142876 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1170187951 20:13612902-13612924 GTGCTGGGAGAGAAGATGGAGGG - Intronic
1171187501 20:23133282-23133304 ATGATGGCACTGACAATGGAGGG + Intergenic
1172126768 20:32629105-32629127 TTGCTGGGACTGAAAGTGGGAGG - Intergenic
1173013589 20:39204800-39204822 TTGCTGGACTTGAAAATGGAAGG - Intergenic
1173274739 20:41569974-41569996 GTGCTTGGACTGATGATGGAAGG - Intronic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1174703234 20:52630385-52630407 ATGCTGGCTGTGAAGATGGAGGG + Intergenic
1175182672 20:57159687-57159709 GTGCTGGCTGTGAAGATGGAGGG + Intergenic
1177282681 21:19004087-19004109 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1177328241 21:19621886-19621908 TTGCTGGCTTTAAAAATGGAGGG + Intergenic
1177583501 21:23058914-23058936 TTGCTGGTTTTGAAAATGGAAGG + Intergenic
1177865756 21:26511574-26511596 GTGCTGGCTTTTAAAATGGAGGG + Intronic
1178155761 21:29852074-29852096 GTGCTGACAATGGGAATGGAGGG - Intronic
1178258115 21:31073965-31073987 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1178423920 21:32463861-32463883 GAGCTGGCACAGAAAGAGGATGG - Intronic
1179257763 21:39731602-39731624 TTGCTGCCTTTGAAAATGGAGGG + Intergenic
1179340374 21:40502585-40502607 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1179468765 21:41596735-41596757 ATGCTCGCTCTGAAACTGGAGGG - Intergenic
1180110743 21:45648013-45648035 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1181618670 22:24072460-24072482 CTGGTGGCACAGAGAATGGAAGG - Exonic
1182076163 22:27496846-27496868 CTCCAGGCACTGAAAAAGGAAGG + Intergenic
1183278191 22:36914580-36914602 GTACTGGCCCTGAGAATGAAAGG + Intronic
1183340068 22:37275166-37275188 GTGCTGGGATTTCAAATGGAGGG - Intergenic
1184463626 22:44655946-44655968 TTGCTGGCTGTGAAGATGGAGGG + Intergenic
1184901625 22:47449930-47449952 GTGCTGGTTTTGAAAATGGAAGG - Intergenic
949165338 3:933920-933942 GTACTGGCTCTGAAAGTGGATGG + Intergenic
949628965 3:5901487-5901509 TTGCTGGCACTGCAAATGCTGGG - Intergenic
950822729 3:15778562-15778584 TTGCTGGCTTTGAAGATGGAGGG - Intronic
951565098 3:24005216-24005238 GTGGTGGCAAAGAAAATAGAAGG - Intergenic
952538516 3:34339829-34339851 TTGGAGGCAATGAAAATGGATGG + Intergenic
952736336 3:36695149-36695171 GAGCTGGGAGTGAAAAAGGAAGG - Intergenic
952853560 3:37749216-37749238 TTGCTGGCTTTGAAGATGGAAGG - Intronic
953366773 3:42351984-42352006 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
953531775 3:43746045-43746067 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
953581168 3:44157930-44157952 TTGCTGACTTTGAAAATGGAAGG + Intergenic
955070472 3:55568601-55568623 GTGATGGCAGTGGAGATGGAGGG - Intronic
955105672 3:55895542-55895564 GTGCAGGCAATGAAAACTGAAGG - Intronic
955958913 3:64319060-64319082 TTGCTGGCTTTGTAAATGGAGGG - Intronic
957796762 3:85019181-85019203 GTTTTGGCACTGAAAATGCTGGG + Intronic
958996938 3:100915772-100915794 GTGCAGGCACTGGAAGTGGAAGG - Intronic
959123068 3:102255934-102255956 TTGCTGGCTTTGAAGATGGAAGG + Intronic
959192669 3:103135065-103135087 GTGCTGGCTTTGAAGATGAAAGG - Intergenic
959459113 3:106602795-106602817 GTGCTCTAACTGAAAATGAAAGG - Intergenic
960305397 3:116054157-116054179 CTGCTGGCTTTGAAGATGGAAGG - Intronic
961578144 3:127855426-127855448 CTGCTGGCTCTGAAGATGGAGGG - Intergenic
961954657 3:130789063-130789085 GTTATTGCACAGAAAATGGAGGG - Intergenic
962089714 3:132230457-132230479 GTGGTGGCACTGACAGTGCAGGG - Intronic
963960192 3:151301137-151301159 ATGCTGGCACCCAAAAAGGAGGG - Intronic
965635508 3:170776344-170776366 GTTATAGCACTGAGAATGGAAGG - Intronic
966990439 3:185224790-185224812 GTGCTGGCTTTGAAGATGGCAGG - Intronic
967384449 3:188897809-188897831 GTGCTGGAGAGGAAAATGGAAGG - Intergenic
969138341 4:5049149-5049171 GTGCTGGCGCTGAGACTGGAAGG - Intergenic
969857532 4:10012456-10012478 GTGCTGGCACTGCAGAAGCAAGG + Intronic
970510493 4:16777131-16777153 GTGCAGGCACTGGAAGTAGAGGG + Intronic
970886641 4:20993947-20993969 TTGCTGGCACTAACAATGGAAGG - Intronic
972420095 4:38879012-38879034 GTGCAGGCACTGAAAGGGGAGGG - Intronic
972434115 4:39015439-39015461 TTGCTGGCTTTGAAGATGGAAGG + Intronic
974070956 4:57123132-57123154 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
974071057 4:57123973-57123995 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
975264682 4:72348738-72348760 TTGCTGGCTCTGGAGATGGATGG + Intronic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
975743538 4:77453654-77453676 GTGCTGGGCCTGATAAGGGAGGG - Intergenic
978352412 4:107833892-107833914 TTGCTGGCTTTGAAAATGGAAGG + Intronic
981138012 4:141235375-141235397 GTGCTTGCCCTTAACATGGAGGG - Intergenic
983111838 4:163760165-163760187 CTGCTGGCTGTGAAGATGGAAGG - Intronic
984402311 4:179282203-179282225 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
984523634 4:180830169-180830191 TTGCTGGCTTTGAAAATGGAAGG - Intergenic
985170166 4:187140191-187140213 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
986829182 5:11557509-11557531 GTGCTGGCTTTGAAGACGGAGGG - Intronic
986846655 5:11764156-11764178 TTGCTGGCATTGAAGATGGAAGG + Intronic
988252518 5:28778311-28778333 CTGCTGGCTTTGAAAATGGAGGG - Intergenic
988360241 5:30228364-30228386 ATGCTGGCAGAGCAAATGGAGGG + Intergenic
989069247 5:37493345-37493367 TTGCTGACCCTGAAGATGGAGGG - Intronic
990214541 5:53515485-53515507 TTGTTGGCTCTGAAATTGGAAGG - Intergenic
990819797 5:59825407-59825429 GTGGTGGCACTGCACATGGGTGG + Intronic
991417998 5:66411366-66411388 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
991944082 5:71882844-71882866 GGGCTTGCCCAGAAAATGGAAGG - Intergenic
992504058 5:77368085-77368107 ATGCTGCTACTGAAAATGGGAGG - Intronic
992713001 5:79479495-79479517 GTGCTGGCTCTAAAGATGAAGGG + Intronic
993071541 5:83170613-83170635 TTGCTGGCTTTGAATATGGAGGG - Intronic
994278280 5:97866274-97866296 GTGATGGCACTGATAAACGAAGG - Intergenic
996049159 5:118912255-118912277 GTACTTGGACTGAAAATGGCAGG + Intronic
996669701 5:126102345-126102367 GTACTGGCATAAAAAATGGACGG - Intergenic
996929216 5:128866294-128866316 TTGCTGGCTTTAAAAATGGACGG + Intronic
997719837 5:136069438-136069460 GTGGTGGCACTAGAGATGGAAGG + Intergenic
1001176396 5:169472867-169472889 GTGCTGGCTTTGAAGATGGAAGG - Intergenic
1002340515 5:178513775-178513797 GTGCTGACCGTGAAGATGGAGGG - Intronic
1002963099 6:1935985-1936007 GGGCTGGAAGTGAAAATGGAAGG + Intronic
1003007813 6:2398031-2398053 GTGGTGACACTGAAAAGAGAAGG + Intergenic
1003192750 6:3888719-3888741 ATCCTGGCCCTGAAAGTGGAAGG + Intergenic
1003681859 6:8264906-8264928 GTGCTTGAACTGAAAAGAGAAGG + Intergenic
1003699277 6:8444280-8444302 TTGCTGGCTTTGAAAATGGAAGG - Intergenic
1004905625 6:20234718-20234740 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1005257802 6:24022998-24023020 TTGCTGGCTCTGAAAATCCAAGG + Intergenic
1007023101 6:38542488-38542510 GTGATGGCAGTGGAAATGCAGGG - Intronic
1007781142 6:44255502-44255524 GTGCTGGCACTGATTGTGGCTGG - Exonic
1007849842 6:44792508-44792530 GTGCTGGAACTCGAAATGTAAGG - Intergenic
1009771564 6:68150272-68150294 GTGCAGTCACTGAAAATACAGGG + Intergenic
1010397036 6:75404505-75404527 CTGCTGCCACTGCAAATGCATGG + Intronic
1010544236 6:77130194-77130216 ATGCTGGCAGAGAAAAAGGAAGG + Intergenic
1010995411 6:82526383-82526405 GCGCTGCCACTGAAGATGGGAGG + Intergenic
1011205428 6:84889524-84889546 GTGATGGCAGTGAAAAGTGAAGG + Intergenic
1011479965 6:87784118-87784140 TTGCTGGCTGTGAAGATGGAGGG + Intergenic
1011642525 6:89429165-89429187 GTTCTGGCATTGCAAATGAAAGG + Intergenic
1011899847 6:92278725-92278747 GTGCTGGAACTTAAAATGTAAGG + Intergenic
1012699473 6:102435716-102435738 GTGCTGGCACAGACAAGGGGAGG + Intergenic
1013817173 6:114112321-114112343 TTGCTGGCATTGAAGATGCAAGG + Intronic
1013982696 6:116151177-116151199 GTGCAGGCACTGAAGTTGGCAGG - Intronic
1014096751 6:117469621-117469643 GTGCTCGCACTCAACATGAATGG - Intronic
1014247073 6:119080282-119080304 GTGCTTCCACTGAAAAGAGATGG + Intronic
1014844669 6:126260563-126260585 GTGCTACAACTGAAAATGGAAGG - Intergenic
1015238912 6:131002183-131002205 GTGCTGGCACTGGTGATCGAAGG - Intronic
1016347652 6:143131562-143131584 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1016377751 6:143441004-143441026 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1016761936 6:147747322-147747344 GGACTGGCCCTGCAAATGGAGGG + Intergenic
1019844156 7:3480234-3480256 TTGCTGGCTGTGAAGATGGAAGG + Intronic
1020058806 7:5136944-5136966 TTTCTGGCTTTGAAAATGGAGGG + Intergenic
1020886550 7:13825130-13825152 TCCCTGGCACTGAAAATGAAAGG + Intergenic
1021837690 7:24696485-24696507 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1022314594 7:29233698-29233720 TTGCTGGCCCTGAAGATGCAAGG + Intronic
1023653025 7:42390489-42390511 GTGATGGCACTGCAAAGGCAGGG - Intergenic
1024014033 7:45294903-45294925 GTGCAGGCAAAGAACATGGAAGG + Intergenic
1024689092 7:51780187-51780209 GACTTGGCACTGAAAATTGAGGG + Intergenic
1025018736 7:55464184-55464206 GTGCAGGCACTAGAAGTGGAAGG + Intronic
1028667771 7:93366556-93366578 CTGCAGGCACTAAAAATTGAAGG - Intergenic
1029186964 7:98746318-98746340 GTGCTGGAATTACAAATGGAAGG + Intergenic
1029606334 7:101601510-101601532 GTGCTGGCAGTGGAAATGGCTGG + Intergenic
1029902043 7:104051871-104051893 ATGATGGCAGAGAAAATGGAGGG + Intergenic
1030788212 7:113688991-113689013 GTGATGGCAATGAAAATGGCAGG + Intergenic
1030837399 7:114306835-114306857 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1030985703 7:116239176-116239198 GTGCTGGCTTTGAAGATGGAAGG - Intronic
1031331024 7:120464814-120464836 TTGCTGGCTTTGAAGATGGACGG - Intronic
1031781504 7:125973220-125973242 GTGCAGGCACAGAAAATAGTTGG - Intergenic
1031822110 7:126515687-126515709 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1032876823 7:136046802-136046824 CTGCTGGCTCTGAAGATGAACGG - Intergenic
1035483965 7:159208020-159208042 GTGCTGGCAATGAGGATGGCAGG + Intergenic
1038386804 8:27156210-27156232 GGGCTGGAACTGGAACTGGAGGG - Intergenic
1038502689 8:28059021-28059043 GTGTTGGCATTGGAAAGGGAGGG + Intronic
1038747691 8:30268695-30268717 GTCCCAGCACTGGAAATGGAAGG - Intergenic
1039135374 8:34316769-34316791 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1041089380 8:54288091-54288113 GGGCTGATACTGAAAATGGCTGG - Intergenic
1041758749 8:61341270-61341292 GCACTGGGACTGAAATTGGACGG + Intronic
1041775619 8:61519736-61519758 CTGCTGGCTCTGAAGATGGAAGG + Intronic
1041885090 8:62799096-62799118 TTGTTGGGACTGGAAATGGAGGG + Intronic
1042355512 8:67823508-67823530 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1042985661 8:74580282-74580304 TTGCTGGCTCTGAAGATGGAGGG - Intergenic
1043341901 8:79249942-79249964 GTGATGTCACTGTAATTGGAAGG + Intergenic
1043403888 8:79911206-79911228 TTGCTGGCTCTGATAATGCAAGG + Intergenic
1043590599 8:81828788-81828810 TTGCTGGCTTTGAAGATGGAGGG + Intronic
1043672702 8:82908013-82908035 CTGCTGGTTTTGAAAATGGAGGG + Intergenic
1044000102 8:86868986-86869008 TTGCTGGCTTTGAAGATGGAGGG + Intronic
1045610749 8:103838251-103838273 TTGCTGGCTTTGAAAATGGAGGG - Intronic
1045635224 8:104178365-104178387 TTGCTGGCTTTGAAAATGGAAGG - Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1047208895 8:122824920-122824942 CTGCTGGCTTTGAAGATGGACGG - Intronic
1047215655 8:122873853-122873875 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1047295863 8:123570067-123570089 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1047969894 8:130075490-130075512 CTGCTGGCACTGAAAATCCAAGG + Intronic
1048857646 8:138697991-138698013 GTGCTGGGACTCAAGGTGGAGGG + Intronic
1051228415 9:14927525-14927547 ATGCTGTCACTGAAAAATGATGG + Intergenic
1051440914 9:17081662-17081684 TTGCTAGCATTGAAGATGGAGGG - Intergenic
1052021117 9:23526221-23526243 GTGCGTGGCCTGAAAATGGAGGG + Intergenic
1054944791 9:70784237-70784259 GTGGTGGCACTCATAGTGGAAGG - Exonic
1055307245 9:74942687-74942709 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1055732519 9:79293015-79293037 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1056053652 9:82797632-82797654 CTGCTGTCACTGATCATGGATGG - Intergenic
1056058914 9:82862170-82862192 GTGCGGGCACTGAAGATGGAGGG - Intergenic
1056343215 9:85660100-85660122 GTTCTGGCAATTAAAATGTAGGG + Intronic
1057014975 9:91643234-91643256 GTGTTGGCTCTGAACCTGGATGG - Intronic
1057256244 9:93549914-93549936 GTGCTGTTACTGAGAAGGGAAGG + Intronic
1057932848 9:99211527-99211549 GTGCTGGCAGTGACAGTGGTAGG + Intergenic
1058564738 9:106270514-106270536 GTTGTGGCCATGAAAATGGATGG - Intergenic
1059284775 9:113162930-113162952 GTGCAGGCACTGAGGCTGGAGGG + Exonic
1059603591 9:115808775-115808797 CTGCTGCCAAGGAAAATGGATGG + Intergenic
1060854263 9:126902362-126902384 GTCCTGGCACTAGGAATGGAAGG + Intergenic
1061694942 9:132365681-132365703 TTGCTGGCTCTGAAGCTGGAAGG + Intergenic
1062670391 9:137705557-137705579 GTTGTGGCACTAAAAATGTAAGG + Intronic
1185755145 X:2647315-2647337 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1186361080 X:8842407-8842429 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1186421852 X:9432965-9432987 TTCCTGTCACTGAAACTGGAGGG - Intergenic
1187106926 X:16252844-16252866 GTGGTGGAAATGAAAATGCAAGG + Intergenic
1187508945 X:19900333-19900355 CTGCTGGCTCAGAAAATAGAAGG - Intergenic
1187728165 X:22225135-22225157 GTGCTGGCTTTGAAAAACGAAGG - Intronic
1188254288 X:27941075-27941097 TTGCTGGCATTGAAGATGGAGGG - Intergenic
1189057049 X:37708325-37708347 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1189729622 X:44005338-44005360 TTACTGGCTTTGAAAATGGAAGG - Intergenic
1193214619 X:78848945-78848967 GTGCTAGCACAGAACATGGAAGG - Intergenic
1194261439 X:91700282-91700304 GGGAAGGCACTGAGAATGGATGG - Intergenic
1194266593 X:91761069-91761091 TTGCTGGCTCTGAAGATGGAGGG - Intergenic
1199311237 X:146322313-146322335 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1200228349 X:154431731-154431753 TTGCTGGCCCTGAGAATGCACGG + Intronic
1200583798 Y:4981983-4982005 TTGCAGGCTCTGAAGATGGAGGG - Intergenic
1201368870 Y:13238401-13238423 GCGCTGGCAGTGACAGTGGAAGG - Intergenic