ID: 1088619944

View in Genome Browser
Species Human (GRCh38)
Location 11:111671555-111671577
Sequence CTCCAATCACAGCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088619944_1088619949 5 Left 1088619944 11:111671555-111671577 CCTTGGCCTGGCTGTGATTGGAG 0: 1
1: 0
2: 3
3: 32
4: 280
Right 1088619949 11:111671583-111671605 CTCATACTGGGCACAGACCTTGG 0: 1
1: 1
2: 4
3: 14
4: 165
1088619944_1088619947 -7 Left 1088619944 11:111671555-111671577 CCTTGGCCTGGCTGTGATTGGAG 0: 1
1: 0
2: 3
3: 32
4: 280
Right 1088619947 11:111671571-111671593 ATTGGAGATGTCCTCATACTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1088619944_1088619946 -8 Left 1088619944 11:111671555-111671577 CCTTGGCCTGGCTGTGATTGGAG 0: 1
1: 0
2: 3
3: 32
4: 280
Right 1088619946 11:111671570-111671592 GATTGGAGATGTCCTCATACTGG 0: 1
1: 0
2: 0
3: 1
4: 93
1088619944_1088619951 28 Left 1088619944 11:111671555-111671577 CCTTGGCCTGGCTGTGATTGGAG 0: 1
1: 0
2: 3
3: 32
4: 280
Right 1088619951 11:111671606-111671628 TGATGATGCTGTCCATGTCCAGG 0: 4
1: 11
2: 20
3: 36
4: 267
1088619944_1088619952 29 Left 1088619944 11:111671555-111671577 CCTTGGCCTGGCTGTGATTGGAG 0: 1
1: 0
2: 3
3: 32
4: 280
Right 1088619952 11:111671607-111671629 GATGATGCTGTCCATGTCCAGGG 0: 10
1: 14
2: 9
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088619944 Original CRISPR CTCCAATCACAGCCAGGCCA AGG (reversed) Intronic
900213585 1:1469009-1469031 CTGGAATCTCAGCGAGGCCAAGG + Exonic
900224874 1:1528323-1528345 CTCCCCTCACAGCCAGGGCCTGG - Intronic
900495426 1:2973926-2973948 GTCCGGTCACAGCCAGGGCAGGG + Intergenic
900543568 1:3216325-3216347 CTCCAGTGACATCCATGCCACGG + Intronic
900937629 1:5776538-5776560 GCCCCATCACAGCCAGACCAAGG - Intergenic
901830867 1:11891649-11891671 CTGTAATCCCAGCAAGGCCAAGG + Intergenic
902384951 1:16071242-16071264 CTGCACTCACAGCCAGCCCTCGG - Intronic
902721443 1:18306911-18306933 CTCCAGGCACAGCCAGGACTGGG + Intronic
903188730 1:21644385-21644407 CTCCAATCTCAGCTTTGCCAAGG + Intronic
904538962 1:31219793-31219815 CCACAATCACAGCCAGCACATGG - Intronic
906892616 1:49733799-49733821 CTACAACCAAAGCCAGGCAATGG + Intronic
907839611 1:58143737-58143759 CTCCAATAACAGCATGGCAAAGG + Intronic
908009533 1:59761855-59761877 CTAAAATCACAGCCTGACCAAGG - Intronic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
910416377 1:87003178-87003200 CTTTAATCACAGCCAGTCAAGGG - Intronic
910700624 1:90070265-90070287 CTCACATCAGAGCCATGCCAAGG - Intergenic
910813188 1:91258760-91258782 CAACAATGACAGCCAAGCCAAGG + Intergenic
913662104 1:121013182-121013204 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914013478 1:143796367-143796389 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG + Intergenic
914652103 1:149704976-149704998 CTCCCATAGCAACCAGGCCAGGG - Exonic
915082613 1:153362333-153362355 CTCCCCTCACAGCCTGGCTATGG + Intergenic
917982723 1:180281640-180281662 CTCCCTGCACAGCCAGGCAAAGG - Intronic
918943027 1:191026410-191026432 CTCCAGCCTCAGCCAGCCCAGGG + Intergenic
919931651 1:202225126-202225148 TCCCAATCACAGCCAGTCCCAGG + Intronic
920190683 1:204191763-204191785 CTCCTACCTCAGCCAGGCCCTGG - Intronic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
921762472 1:218932013-218932035 CTGTAATCACAGGAAGGCCAAGG + Intergenic
922788243 1:228294333-228294355 CATCCACCACAGCCAGGCCACGG - Exonic
923116737 1:230947408-230947430 CTCCCACCCCAGCCTGGCCAGGG - Intronic
923121685 1:230998149-230998171 CTCCAGTCACAGCCAGACTGTGG + Intronic
923555286 1:234995205-234995227 CTCCAAGCACAGCCTGCCCAGGG - Intergenic
923718360 1:236446220-236446242 AAGCAATCATAGCCAGGCCAAGG - Intronic
1067234672 10:44437596-44437618 CTCCAGTACCAGCCAGGCCCTGG - Intergenic
1067344601 10:45428200-45428222 CCCCAGTCAGAGCCAGGACAGGG - Intronic
1067469725 10:46527744-46527766 CTCCGGCCACAGCCAGTCCAGGG - Intergenic
1067944647 10:50682337-50682359 CTCCCATCCCAGCCTGGCCAGGG + Intergenic
1068091933 10:52442455-52442477 CCCTAATCACAGCCAGTCCGTGG + Intergenic
1069596644 10:69676291-69676313 ACCCAAGCACAGCCAGGGCAGGG + Intergenic
1070825406 10:79387702-79387724 AGCCATTCACAGCCTGGCCAGGG - Intronic
1070866149 10:79709208-79709230 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1070879943 10:79847339-79847361 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG + Intronic
1071633052 10:87231429-87231451 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071646501 10:87363647-87363669 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1072618854 10:97066943-97066965 CACCCACCACAGCCAGCCCAGGG - Intronic
1072739356 10:97900484-97900506 CTCCAATCACTACCAGGAAAAGG - Intronic
1072739388 10:97900612-97900634 CTCCAATCACTACCAGGAAAAGG - Intronic
1072739420 10:97900740-97900762 CTCCAATCACTACCAGGAAAAGG - Intronic
1072739454 10:97900868-97900890 CTCCAATCACTACCAGGAAAAGG - Intronic
1072739469 10:97900932-97900954 CTCCAATCACTACCAGGAAAAGG - Intronic
1072739485 10:97900996-97901018 CTCCAATCACTACCAGGAAAAGG - Intronic
1073432026 10:103493327-103493349 CTCCGTTCTCAGCCAGGCTAGGG - Intergenic
1075401219 10:122163072-122163094 CTCCCCTCACAGCCAGCCCGGGG - Intronic
1075814809 10:125256718-125256740 CTCCCCTCACATCCTGGCCATGG - Intergenic
1076701511 10:132275596-132275618 GTCACAGCACAGCCAGGCCACGG + Intronic
1077530009 11:3090630-3090652 CTCCGGCCACAGCCAGGCCACGG - Exonic
1077757000 11:5042148-5042170 CTGTAATCCCTGCCAGGCCAAGG - Intergenic
1081754906 11:45537569-45537591 TTCTAATGACAGCCATGCCATGG - Intergenic
1083391237 11:62352092-62352114 CTCCAAACACAGCCAGATTAGGG - Intronic
1084321233 11:68374375-68374397 CGCCAATCACTGCCCGGCCGCGG - Intronic
1084632759 11:70365333-70365355 CACCAACCACATCCAGGGCAAGG - Intronic
1084860709 11:72016056-72016078 CTCCAACCTCAGCCAGGCCAAGG - Exonic
1085456814 11:76670257-76670279 CTCCGATCCCAGCCAGGCGTGGG - Intronic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089301853 11:117503790-117503812 CCCAAATCACAGCCAAGCCCCGG - Intronic
1089599266 11:119603474-119603496 CACCAACCACAGCCAGGCTGAGG - Intergenic
1089771243 11:120804762-120804784 ATCCAATCAGAGCCAGACCTTGG - Intronic
1091716313 12:2779144-2779166 CTCCTATCACAGACAAGCCCAGG - Intergenic
1092043585 12:5407480-5407502 CTGCACTCACAGCCAAGACAGGG + Intergenic
1092944650 12:13441483-13441505 CTCCCAGCACAGCCATGCCAGGG - Intergenic
1093873088 12:24316049-24316071 CTGCAGGCACAGCCATGCCAGGG + Intergenic
1096155881 12:49341389-49341411 CTGCCATCACGGCCAGGCCCAGG + Intergenic
1097158046 12:57026945-57026967 CTCCCATCACCCCCAGCCCAGGG + Intronic
1099598228 12:84696521-84696543 CTCCAAACAGAGCCAGGAAATGG - Intergenic
1100197333 12:92261931-92261953 CTCAAATCCCAGCCCTGCCATGG - Intergenic
1103341072 12:120221463-120221485 CTGGCATCACAGCAAGGCCAGGG + Intronic
1103447700 12:121004898-121004920 CTCCAGTCAGGACCAGGCCAAGG - Intronic
1103800426 12:123533975-123533997 CCCCAATCCCGGCCTGGCCAGGG + Intergenic
1104571728 12:129932005-129932027 GTCCAATCAGAGCGAGGCCCAGG - Intergenic
1104749783 12:131231132-131231154 CTGCAATCCCAGCCAAGCCCAGG + Intergenic
1104887227 12:132117706-132117728 CTCCAATCACAGAGCAGCCAGGG + Intronic
1105899349 13:24742348-24742370 CTCCCATCCCAGACATGCCAAGG + Intergenic
1109687353 13:65838787-65838809 CAGCACTCACAGCCAGGCCATGG - Intergenic
1110491124 13:76109303-76109325 CTCCAACCACTGACAGGCCCTGG + Intergenic
1110617108 13:77553597-77553619 CTCCAAACACAGCCAGCCAGGGG + Intronic
1111957014 13:94770394-94770416 CGCCACCCACAGCTAGGCCATGG - Intergenic
1112261714 13:97883683-97883705 CTTCAATCCCAGCCCGGCCTTGG + Intergenic
1113194406 13:107785398-107785420 CTCCAATCTCATCCAGGTCGAGG - Intronic
1113405057 13:110031352-110031374 CTCCAAATGCAGCCACGCCAGGG + Intergenic
1114705037 14:24715989-24716011 CTCTAATCACAGCCTTGCCTTGG - Intergenic
1117411404 14:55454659-55454681 ATCCCATCAGAGGCAGGCCAGGG + Intronic
1117639275 14:57780282-57780304 CACCAACAACAGCCAAGCCAAGG + Intronic
1118197111 14:63637651-63637673 CTCCAGTCTCATCCAGGTCATGG - Intronic
1119613065 14:76080168-76080190 CAGCGATGACAGCCAGGCCAAGG - Intronic
1120993792 14:90399608-90399630 CTGCCATCACAGCCAGGATAAGG - Intronic
1121332136 14:93056281-93056303 CACCAAGAACCGCCAGGCCAAGG + Intronic
1122033587 14:98931617-98931639 GTCCACACCCAGCCAGGCCAGGG + Intergenic
1122724178 14:103739730-103739752 CTCCCAGCACAGCCTGACCAAGG + Intronic
1122974892 14:105167044-105167066 CTCCCAGCACGCCCAGGCCAGGG + Intronic
1122994059 14:105253146-105253168 CTCCCATCACTGCCAGCCCTCGG - Intronic
1123010518 14:105347444-105347466 CGCCAGACACAGTCAGGCCATGG - Intronic
1123135177 14:106021517-106021539 CTCCAGTCACACTCAGGACAGGG - Intergenic
1123166940 14:106334707-106334729 CTCCAATCAGACCCAGGACAGGG - Intergenic
1123169554 14:106359418-106359440 CTCCAATCAGACCCAGGACAGGG - Intergenic
1123585723 15:21759387-21759409 CTCCAGTCACACTCAGGACAGGG - Intergenic
1123622365 15:22201975-22201997 CTCCAGTCACACTCAGGACAGGG - Intergenic
1124078255 15:26466746-26466768 CACCAATAACAGTCAGGTCAAGG + Intergenic
1125745448 15:41994431-41994453 CACCAGTCACAGACAGGACACGG + Intronic
1125789751 15:42355528-42355550 GTCCAATCAGAGCCAGGGAAAGG + Exonic
1128061468 15:64738372-64738394 CTCCACTCAGACCCAGGCCTGGG + Intergenic
1128233811 15:66053666-66053688 CTCCATTCCCAGCCAGGGCCAGG + Intronic
1128509846 15:68306667-68306689 AACCAATCACAGCCAGGGCAGGG - Intronic
1128727468 15:69998778-69998800 CAGCACTCACGGCCAGGCCAGGG + Intergenic
1129828794 15:78653485-78653507 GTCCACTGACAGCCAGGCAAAGG + Intronic
1130217889 15:81989401-81989423 CTTCAATCACAGCCAGGCCTGGG + Intergenic
1132690650 16:1180554-1180576 CTGCAGTCACAGCCAGGCCGTGG + Intronic
1133288801 16:4704381-4704403 ACCCACTCATAGCCAGGCCAAGG - Intronic
1136126844 16:28189480-28189502 GTCCTATCACAGTCAGGCTAAGG - Intronic
1136870592 16:33804031-33804053 CTCCAATCAGACCCAGGACAGGG + Intergenic
1137555286 16:49466604-49466626 TGGCATTCACAGCCAGGCCATGG - Intergenic
1137675256 16:50300908-50300930 CTCCATCCACAGCCAGCCCCAGG - Intronic
1138420751 16:56897653-56897675 TTCCATTCAGAGCCAGGACAGGG - Intronic
1138458557 16:57134694-57134716 CACCACCCACTGCCAGGCCAAGG - Intronic
1140071751 16:71656584-71656606 CTGCCATCTCAGCCAGTCCATGG + Exonic
1142215199 16:88826478-88826500 GTCCAAGCACAGCGAGGCCCTGG - Intronic
1203101580 16_KI270728v1_random:1312027-1312049 CTCCAATCAGACCCAGGACAGGG - Intergenic
1142808326 17:2383372-2383394 CTCCCATGACAGCCTGCCCAGGG + Intergenic
1143487181 17:7261518-7261540 CTCCATTCCCGGGCAGGCCATGG - Intronic
1143729913 17:8875605-8875627 CTCGGATCACAGGGAGGCCAGGG - Intergenic
1144635844 17:16908496-16908518 CTCAGACCTCAGCCAGGCCAAGG + Intergenic
1144725115 17:17497960-17497982 CAGGAATCAGAGCCAGGCCAGGG - Intergenic
1145121928 17:20267839-20267861 CTCAGACCTCAGCCAGGCCAGGG + Intronic
1147350106 17:39835573-39835595 CGCCAACCGCAGCCAGGCCAAGG - Intronic
1147775914 17:42901059-42901081 CTCCAATCACAGCTACCCAAAGG - Exonic
1148092511 17:45031092-45031114 CTCCTGCCCCAGCCAGGCCAGGG - Intronic
1148722713 17:49765245-49765267 CCCCAATCACAGACAATCCAGGG - Intronic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1149045434 17:52239320-52239342 CACCAATCACTGGCAGGACAGGG + Intergenic
1149684780 17:58529048-58529070 CCCCAATCCCAGCCAAGGCAGGG + Intronic
1150007555 17:61479212-61479234 CTCCTATCACAGCCTGGGAAGGG - Intronic
1150895651 17:69207740-69207762 CTCCACCCACTGCCAGGCCCTGG - Intronic
1151522025 17:74637061-74637083 CTCCAAACACAGACAGGACTTGG + Intergenic
1151653667 17:75485570-75485592 CTGCCATCCCAGCCAGGCCCTGG - Intronic
1151718344 17:75842786-75842808 CTCCCATCACAGCCTGGCCCAGG - Intronic
1152323925 17:79624720-79624742 CTCCACTCACAGGCAGCCCTTGG + Intergenic
1152590183 17:81207849-81207871 CACCACCCTCAGCCAGGCCACGG - Intronic
1153989318 18:10381915-10381937 CACCATTCACAGGCTGGCCATGG + Intergenic
1154192956 18:12245699-12245721 CTCAAACCACGGCCATGCCAGGG + Intergenic
1156486914 18:37472205-37472227 CTTCCAGCACAGCCAGGCCTTGG + Intronic
1157440434 18:47707501-47707523 CTCCTGTTACATCCAGGCCAGGG - Intergenic
1158935753 18:62363171-62363193 ATCAAATCACAGCAAGGCAAAGG - Intronic
1160679838 19:407614-407636 CGCCCAGGACAGCCAGGCCAAGG - Exonic
1161161057 19:2762126-2762148 CCCCACTCACCCCCAGGCCAGGG + Intronic
1161324765 19:3658298-3658320 CATCACTCCCAGCCAGGCCATGG - Intronic
1161393002 19:4031145-4031167 CTCCTGGCACAGCCAGGCCCAGG + Intronic
1161495099 19:4582025-4582047 CCCCAATCACACCCAGCCCATGG + Intergenic
1161576741 19:5058562-5058584 CTCCCACCACACCCAGGCCCTGG - Intronic
1162295572 19:9811129-9811151 CCTCCAGCACAGCCAGGCCAGGG + Exonic
1162932140 19:13962589-13962611 CTCCAGCCTCAGCCAGGGCAGGG - Exonic
1162966154 19:14157074-14157096 CTCCAGGCACAGCCAGGAGAAGG + Exonic
1163262980 19:16202330-16202352 CTCCAACCGCAGCCATGCCCAGG + Intronic
1163265427 19:16217817-16217839 CTCCAGCCTAAGCCAGGCCAGGG - Intronic
1163446103 19:17347415-17347437 CTCCAATCCCACCCAGGCACAGG - Intergenic
1165079266 19:33298377-33298399 ATCCAATCACATCCAGCCCCAGG - Intergenic
1165488690 19:36110930-36110952 CACCAAGCAGAGCCAGGCAAGGG - Intergenic
1165758500 19:38307692-38307714 CTCCAGGGTCAGCCAGGCCAGGG + Exonic
1168587901 19:57608881-57608903 GTTCAATAACAGCCTGGCCAAGG + Intronic
925059721 2:881534-881556 CTCCTGTCACACCCAGGCTAGGG - Intergenic
925567752 2:5274517-5274539 CTCCAATCTCATCCAGGTCATGG + Intergenic
929087339 2:38181562-38181584 CTCAAATCACAGCCTGACTATGG - Intergenic
933702395 2:85264751-85264773 CTCCAATCAAATCCAGGGCTTGG - Intronic
934771392 2:96909868-96909890 CTCCACTCACAGGTTGGCCAGGG - Intronic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
934949296 2:98565540-98565562 CTCCTGTCACAGCCAGGCCTGGG + Intronic
935301031 2:101694157-101694179 CTCCAAACACAGCCACACTAGGG - Intergenic
937040150 2:118814587-118814609 CTCCATCCTCAGCCAGACCAGGG + Intergenic
937132879 2:119526144-119526166 CACTAATCACAGCCTGGCCCAGG - Intergenic
938317101 2:130337520-130337542 CTCCTATCAGGGCGAGGCCATGG - Intergenic
939054186 2:137343257-137343279 CTCCCATCACAGAAAAGCCAAGG - Intronic
939630673 2:144523722-144523744 CTCCACACACACCCAGTCCAGGG - Intronic
948180508 2:235976146-235976168 CTCCCATCACTGACAGCCCAAGG - Intronic
949025287 2:241764960-241764982 CTCCAAGCACACCCTGGCCCTGG - Intronic
1168788846 20:562634-562656 TTCTGATCCCAGCCAGGCCAGGG - Intergenic
1173342071 20:42161697-42161719 CTACCAACACAGCCAGGCCAGGG - Intronic
1174226773 20:49006968-49006990 CTCCAATGGCAGGCCGGCCACGG - Intronic
1174502175 20:50993327-50993349 CTCCAATCACAGTGAGTCCCAGG + Intergenic
1175939308 20:62530639-62530661 CCCCAGACCCAGCCAGGCCACGG - Intergenic
1175995517 20:62810571-62810593 CTCCAGTCACAGCCAAGGCCTGG - Intronic
1176271209 20:64236109-64236131 CACCCACCACAGCCAGCCCAGGG - Intronic
1176271243 20:64236205-64236227 CACCCACCACAGCCAGCCCAGGG - Intronic
1176367016 21:6039370-6039392 CTCCGGACACAGCCAGGCCTGGG - Intergenic
1179179001 21:39029447-39029469 CTCCAATCACTGAGAGCCCAGGG - Intergenic
1179576590 21:42312188-42312210 CAGCAATCACAGCCGGGCAAGGG + Exonic
1179756502 21:43499176-43499198 CTCCGGACACAGCCAGGCCTGGG + Intergenic
1180048125 21:45319001-45319023 CTCACTTCAGAGCCAGGCCAAGG + Intergenic
1182588911 22:31363974-31363996 CTCCAAGTACAGCCACTCCAGGG - Intergenic
1182713457 22:32336769-32336791 TTCCAAGCAAAGCCAGGGCAGGG + Intergenic
1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG + Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1184400711 22:44272338-44272360 TTCCAAGCAAAGCCAGGGCAGGG + Intronic
1185276026 22:49950506-49950528 CCCCAAACACAGCCCGGCCCAGG - Intergenic
949118551 3:358183-358205 CTCCAAGCACTTCCAGGACATGG - Intronic
950095855 3:10329973-10329995 CTCCAATAACTGGCCGGCCAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954451444 3:50573856-50573878 CTGTATTCACTGCCAGGCCAGGG - Intronic
955070687 3:55570339-55570361 CCCCAATCACAGCATGGTCACGG + Intronic
955723046 3:61903667-61903689 AGCCAATAACAGCCAGGCCCGGG - Intronic
956479574 3:69660612-69660634 CTCCAGCCTCAGCCAGCCCAGGG - Intergenic
958782711 3:98562225-98562247 CTACTATTACAGCAAGGCCAGGG + Intronic
961351646 3:126308062-126308084 CCCCCGTCCCAGCCAGGCCACGG - Intergenic
963142709 3:141960952-141960974 CTCCACTCAAAGGAAGGCCAAGG + Intronic
964624854 3:158748998-158749020 CTCCAACCCCAGCCCAGCCATGG - Intronic
966723465 3:183087616-183087638 CTGTAATCCCAGCAAGGCCAAGG + Intronic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
968949196 4:3681682-3681704 CACCGATCACAGGCAGGCCCAGG - Intergenic
968971643 4:3798748-3798770 CTCCAGTCACCGCCAGGCTCTGG - Intergenic
969325124 4:6439559-6439581 TACCACTCACAGCCAGGCCCTGG + Intronic
969409623 4:7019588-7019610 CTCCCACTTCAGCCAGGCCAGGG - Intronic
969559524 4:7938800-7938822 CTCCAATCAGAGCCCAGCCCGGG + Intronic
969586570 4:8097471-8097493 GTCCACTCACCACCAGGCCAGGG - Intronic
969753885 4:9134787-9134809 CTGCAATCAGAGCCAACCCAGGG + Intergenic
973686703 4:53377691-53377713 CTCCAATCCCAGGAAGGCGACGG - Exonic
975539854 4:75497368-75497390 ATCCAATCACAGGCAGTCCTCGG + Intronic
977928707 4:102729341-102729363 CGCCAACTGCAGCCAGGCCAAGG - Intronic
979705978 4:123721255-123721277 GTCCAATCTCATCCAGGTCATGG - Intergenic
980092625 4:128458232-128458254 CTGTAATCCCAGCCAGGGCAGGG + Intergenic
985042900 4:185910108-185910130 CCCAAATTCCAGCCAGGCCAAGG + Intronic
985669711 5:1201106-1201128 CACCAAGCACAGCGAGGCCCTGG - Intergenic
986308790 5:6535958-6535980 CCTCAACCACAGCCAGGACAGGG - Intergenic
991356474 5:65774363-65774385 CTTGAATCTCAGCCAGGCCATGG - Intronic
992342052 5:75834401-75834423 CTCCAACCACATCCATGCAAAGG - Intergenic
995189061 5:109301586-109301608 CTAAAATCCCAGCCATGCCAAGG + Intergenic
996432948 5:123401511-123401533 CGCCAACCGCAGCCAGGCCGAGG - Intronic
996998958 5:129735322-129735344 GTCCAATCAGAGCCAGGTCCAGG + Intronic
1000097813 5:157986605-157986627 CTCTAAGGCCAGCCAGGCCAAGG - Intergenic
1001644282 5:173268800-173268822 CTCTAATCACAGCTTGGCCTGGG - Intergenic
1001914105 5:175545179-175545201 TTCTAGTCTCAGCCAGGCCAGGG - Intergenic
1002183189 5:177441942-177441964 TGCCAAACTCAGCCAGGCCAGGG - Exonic
1002447084 5:179296315-179296337 CTCCGAGCACAGACAGGCCCCGG - Intronic
1002602904 5:180364175-180364197 CTCTAAACACTGCCAGGCCCAGG - Intergenic
1003053211 6:2797962-2797984 CTCCTCTCACAGCCTGCCCAGGG - Intergenic
1005023273 6:21437960-21437982 CTGCAACCAAAGCCAGGGCATGG + Intergenic
1005736005 6:28747086-28747108 CTCCAAACACAGACAGACAAAGG - Intergenic
1006450881 6:34105199-34105221 TTTATATCACAGCCAGGCCAGGG + Intronic
1006764580 6:36493500-36493522 CTCCCCTCACAGTAAGGCCAAGG - Intergenic
1007519433 6:42440056-42440078 CCCCCATCCCTGCCAGGCCACGG - Intronic
1007753138 6:44081978-44082000 CACCAATCACAGGGAGGCCTGGG + Intergenic
1010335911 6:74683488-74683510 CTCCACTAACAGCCAGCACAAGG + Intergenic
1010587993 6:77678286-77678308 CTGACATCACAGCCAGGCCTTGG - Intergenic
1011092149 6:83615569-83615591 CTCCAATCTCAGCGTGGCCGGGG - Intronic
1011211194 6:84958427-84958449 CTCCAAAAACAGCAAGGCCCTGG - Intergenic
1011662287 6:89604886-89604908 CTCCAATTACATCCAGGCTCTGG - Intronic
1012207930 6:96484052-96484074 CTCCAATCTCATCCAGGTCACGG + Intergenic
1013277397 6:108598833-108598855 CTCCAATGACCACCAGGTCAAGG - Intronic
1013512608 6:110858502-110858524 CTCCAATTTCATCAAGGCCATGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013979691 6:116114969-116114991 CTGCAATCAGACGCAGGCCAAGG + Intronic
1017328944 6:153173113-153173135 CTCCAAGCACAGTCAGGTAATGG + Intergenic
1017391624 6:153946221-153946243 CTCAAATCAGAGCAAGACCAGGG - Intergenic
1017589916 6:155967958-155967980 CTCTATTCACAGCCATGGCAAGG - Intergenic
1017994145 6:159517037-159517059 CACCAACAACAGCCAAGCCAAGG - Intergenic
1018034061 6:159866805-159866827 CCCCAGGCACAGCCAGGCCCCGG - Intergenic
1019429771 7:993289-993311 CTCCAGTCACAGTCAGGCCCTGG - Intergenic
1019632074 7:2054854-2054876 CTCCCATCACTGCGAGGGCACGG - Intronic
1020007802 7:4791617-4791639 CTCCAATCAGAGCCGCTCCATGG - Exonic
1020643148 7:10780254-10780276 CTCCCACGACAGCAAGGCCATGG + Intergenic
1020678484 7:11207781-11207803 CTGCAATCAGAGGTAGGCCAAGG + Intergenic
1020703533 7:11513006-11513028 CTCCAATCTCATCCAGGTCATGG - Intronic
1022959848 7:35415983-35416005 GTACAAGCACAGCCAAGCCATGG - Intergenic
1023752731 7:43387227-43387249 ATCCATTCAAAGCCAGCCCAAGG - Intronic
1025214414 7:57043744-57043766 TTCCACTCACAGCAAGGTCACGG - Intergenic
1025657539 7:63533069-63533091 TTCCACTCACAGCAAGGTCACGG + Intergenic
1025813800 7:64891438-64891460 TTCCAATCATACCCAGGCCTAGG - Intronic
1027699695 7:81454615-81454637 CTCCAATCTCATCCAGGTCATGG - Intergenic
1029110813 7:98212285-98212307 CTCCTAGGACAGCCAGTCCAGGG + Exonic
1031973995 7:128082510-128082532 TTTCAAGCACAGCCAGCCCAGGG - Intronic
1033737191 7:144234177-144234199 CTCCAATGACAGCTGGACCAGGG - Intergenic
1033745866 7:144316769-144316791 CTCCAATGACAGCTGGACCAGGG + Intergenic
1033865456 7:145686047-145686069 CTACAGTCACAGCCATGACAGGG - Intergenic
1034971911 7:155424480-155424502 CCACAATCACAACCAAGCCAAGG - Intergenic
1035439529 7:158884696-158884718 CTCCGATGACGGCCAGTCCATGG + Intronic
1039383621 8:37110151-37110173 CACCAACAACAGCCAAGCCAAGG + Intergenic
1039531568 8:38267931-38267953 CGCCATTCAGAGCCAGGGCAAGG + Exonic
1039989625 8:42476564-42476586 CCCCAAGCAAAACCAGGCCATGG - Intronic
1040570547 8:48605570-48605592 CTCCAACCAAAGCCAGGAAAAGG + Intergenic
1040606583 8:48939236-48939258 CTCCCCTCACCGACAGGCCATGG + Intergenic
1042230793 8:66552488-66552510 CTTCAAATACAGCCATGCCAGGG - Intergenic
1043345359 8:79291718-79291740 CCCCATTCTGAGCCAGGCCATGG - Intergenic
1048478563 8:134766522-134766544 TTCCAATCCCAGCAATGCCAGGG + Intergenic
1049648207 8:143746671-143746693 CTCCAAACAAAGCCTGGGCATGG - Intergenic
1050298222 9:4228560-4228582 CTGCAAATACAGCCAGGGCAAGG + Intronic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1053613890 9:39744049-39744071 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053871924 9:42502006-42502028 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053900825 9:42793971-42793993 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054239626 9:62598348-62598370 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054260825 9:62863575-62863597 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1054553759 9:66632875-66632897 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1055402804 9:75942343-75942365 CTCCCAACACAGCCAACCCAAGG - Intronic
1057354319 9:94321798-94321820 CTCCCATCCCAGCCTGGCCAGGG - Intronic
1057653445 9:96935837-96935859 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1061307400 9:129739989-129740011 ATCCATTCACAGCCAGGTCAAGG + Intronic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1062561435 9:137143906-137143928 CTCCACTCCCGGCCATGCCACGG + Intronic
1186461858 X:9754341-9754363 CTCCCAGCCCAGCCAGGCTAGGG - Intronic
1188653877 X:32666361-32666383 CTCCACTCCCAGACAGGCGATGG + Intronic
1189175994 X:38957757-38957779 CCCCACTCACAGAGAGGCCATGG + Intergenic
1189640179 X:43060383-43060405 CTCCAAACACCGCCACGCTAGGG + Intergenic
1190053740 X:47170307-47170329 CTCCATTCCCACCCTGGCCAGGG - Intronic
1190495304 X:51022927-51022949 CAGAAATCACACCCAGGCCATGG + Intergenic
1190629212 X:52368761-52368783 CCCCCACCACAGCAAGGCCATGG - Intergenic
1190953711 X:55171395-55171417 CTCCCATGACAACAAGGCCATGG - Intronic
1200064505 X:153498014-153498036 CTCTGATCCCAGCCAGCCCAAGG + Intronic