ID: 1088623878

View in Genome Browser
Species Human (GRCh38)
Location 11:111714500-111714522
Sequence CGTGCTCTAACCTGTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088623878_1088623882 -8 Left 1088623878 11:111714500-111714522 CCAGGAAGACAGGTTAGAGCACG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1088623882 11:111714515-111714537 AGAGCACGTGTCCAGGAGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 210
1088623878_1088623883 0 Left 1088623878 11:111714500-111714522 CCAGGAAGACAGGTTAGAGCACG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1088623883 11:111714523-111714545 TGTCCAGGAGGGAGGTGATGAGG 0: 1
1: 0
2: 42
3: 707
4: 4325
1088623878_1088623885 18 Left 1088623878 11:111714500-111714522 CCAGGAAGACAGGTTAGAGCACG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1088623885 11:111714541-111714563 TGAGGCCTGAACTAGAATAGTGG 0: 1
1: 0
2: 3
3: 24
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088623878 Original CRISPR CGTGCTCTAACCTGTCTTCC TGG (reversed) Intronic
912959230 1:114180724-114180746 CCTTCTCTATCCTCTCTTCCAGG - Intergenic
913174525 1:116262010-116262032 CCTCCTCTAAGATGTCTTCCTGG - Intergenic
918065988 1:181102058-181102080 CGGGCTCTTCCCTGTCTTTCTGG + Intergenic
919490844 1:198203249-198203271 GGTGCTTGAAACTGTCTTCCTGG + Intronic
919874432 1:201852989-201853011 TATGCTGTAACCTTTCTTCCAGG + Exonic
921869624 1:220125727-220125749 CTCGCTGCAACCTGTCTTCCAGG - Intronic
924942869 1:248824742-248824764 AGTGCTCTCACCTGTATTCTAGG + Exonic
1063005156 10:1963535-1963557 CGTTTCCTGACCTGTCTTCCCGG + Intergenic
1063671282 10:8102060-8102082 GGTGGGCTAACCTGTCTACCTGG + Intergenic
1067982789 10:51105878-51105900 TTTGCTCTAATTTGTCTTCCAGG - Intronic
1069545167 10:69322494-69322516 CCTACTCTCCCCTGTCTTCCTGG - Intronic
1071215905 10:83401072-83401094 CCTGCTCTGCCCTGTCTCCCTGG - Intergenic
1071371007 10:84951879-84951901 CATGCTCTCATCTGTCTTCAAGG + Intergenic
1075222444 10:120596849-120596871 AGTGCTCATACCTGTATTCCAGG + Intergenic
1080629573 11:34061577-34061599 TCTGCTTTAACCAGTCTTCCAGG + Intronic
1080645734 11:34186335-34186357 CGTGCTCTCACTTGCCTGCCAGG - Intronic
1083673776 11:64314356-64314378 AGTGCTCTCACCTGTCTTCCGGG - Exonic
1085448230 11:76615360-76615382 CTTGCTCTAACGTCACTTCCGGG + Intergenic
1087114990 11:94514969-94514991 AGTGCTCTAACCTGGCTGGCTGG + Intergenic
1088622759 11:111703476-111703498 CATGCTCACACCTGTCATCCTGG + Intronic
1088623878 11:111714500-111714522 CGTGCTCTAACCTGTCTTCCTGG - Intronic
1090203672 11:124873288-124873310 AGTGCTCTGCCCTCTCTTCCAGG + Exonic
1096467551 12:51855803-51855825 AGTGCTCTCACCTCTCCTCCAGG + Intergenic
1097349936 12:58537596-58537618 CGTGCTCTGAAATGACTTCCAGG + Intergenic
1103885714 12:124198719-124198741 AGTGCTATAACCTGACTTCGAGG + Intronic
1106028383 13:25976218-25976240 CATGCTGAGACCTGTCTTCCTGG + Intronic
1109400167 13:61816900-61816922 CATGCTATGACCTCTCTTCCAGG - Intergenic
1112251527 13:97785006-97785028 CGTGCTCTGACCTGGCTTTCTGG - Intergenic
1119046468 14:71321663-71321685 GATGCTCTAACCTGCTTTCCGGG + Intronic
1122610968 14:102983260-102983282 CCTGCTCCAAGCTGGCTTCCTGG - Intronic
1123924600 15:25095285-25095307 GGTGTTCTAATCTGTCTTCGTGG + Intergenic
1124483578 15:30097903-30097925 GGTGCTGGTACCTGTCTTCCCGG - Intergenic
1124490030 15:30149965-30149987 GGTGCTGGTACCTGTCTTCCTGG - Intergenic
1124520000 15:30399323-30399345 GGTGCTGGTACCTGTCTTCCCGG + Intergenic
1124538654 15:30566901-30566923 GGTGCTGGTACCTGTCTTCCCGG - Intergenic
1124753502 15:32388362-32388384 GGTGCTGGTACCTGTCTTCCTGG + Intergenic
1124759997 15:32440681-32440703 GGTGCTGGTACCTGTCTTCCGGG + Intergenic
1124975245 15:34524064-34524086 GGTGCTGGTACCTGTCTTCCCGG + Intergenic
1131045503 15:89311625-89311647 CATGCTCTACCCTGCCTTCCAGG + Intronic
1132932493 16:2466044-2466066 CATGCTCTTTCCTGCCTTCCTGG - Intergenic
1135852841 16:25980268-25980290 CGTGCTCTCAGCCCTCTTCCTGG + Intronic
1142126715 16:88414164-88414186 TGGACTCTACCCTGTCTTCCTGG - Intergenic
1143501793 17:7343566-7343588 CCTGCCCCAATCTGTCTTCCTGG + Intronic
1160160022 18:76464053-76464075 GGTGCTCACACCTGTCATCCCGG + Intronic
1160672828 19:374288-374310 CGTGTCCTCACCTGTCTTTCAGG + Exonic
1160891141 19:1379366-1379388 CGGGGTCAAGCCTGTCTTCCCGG - Intergenic
1164244186 19:23416158-23416180 CCTGCTTTAGCCTGTTTTCCTGG - Intergenic
1164259808 19:23559768-23559790 CGTGATGTAACCGTTCTTCCAGG - Intronic
1166099206 19:40560984-40561006 GGTGGCCTAACCTGTCTGCCAGG + Intronic
926244332 2:11112188-11112210 CGCTATCTAGCCTGTCTTCCAGG - Intergenic
926244339 2:11112218-11112240 CGCCATCTAGCCTGTCTTCCAGG - Intergenic
928195582 2:29214368-29214390 CCTGCTCCAACCTAGCTTCCCGG - Intronic
940524262 2:154792091-154792113 TGTGCTCCTACTTGTCTTCCTGG + Intronic
943309000 2:186303653-186303675 CTTTCTCTACCCTGTCTTCCAGG + Intergenic
945476443 2:210287472-210287494 CTGGCTCTAAGCTCTCTTCCAGG - Intergenic
946246908 2:218393052-218393074 CGTGCTCGTGGCTGTCTTCCGGG + Exonic
947464658 2:230331526-230331548 TGTTCTGTAACCTGTCTTGCTGG + Intronic
1172861259 20:38054193-38054215 CTTTCACTGACCTGTCTTCCAGG - Intronic
1173697316 20:45029735-45029757 GGTGTTTTAACCTGTCCTCCTGG + Intronic
1175888606 20:62306112-62306134 CATCCTCTGACCTGGCTTCCAGG - Intronic
1179812763 21:43882994-43883016 CTTGCTCTCTCCTGCCTTCCAGG - Intronic
1181386293 22:22548261-22548283 CGTGCTGTATCCTGTCCCCCTGG - Exonic
1182686489 22:32124231-32124253 AGTGCTCCCACCTGCCTTCCTGG - Intergenic
1184012328 22:41758522-41758544 TGTGCACTGACCTGTCTTCATGG - Exonic
950355901 3:12408893-12408915 CGTGCTCTTATCTGTGTTACTGG + Intronic
953316592 3:41933165-41933187 TGTGCTTTAACAAGTCTTCCAGG - Intronic
956921815 3:73937897-73937919 GGGGCTGTATCCTGTCTTCCTGG + Intergenic
959239304 3:103768006-103768028 CGGGCTCCATCCTGTGTTCCTGG - Intergenic
961362166 3:126374986-126375008 CGTGGTCTAACATGTCTTCAAGG + Intergenic
964695665 3:159505048-159505070 CTTGCTCTCTTCTGTCTTCCTGG - Intronic
969310434 4:6350007-6350029 CGTGCTCAAATCTTGCTTCCCGG + Intronic
984907811 4:184646417-184646439 AGTGCTCTGTACTGTCTTCCTGG - Intronic
993421458 5:87706622-87706644 TGTGCTATACACTGTCTTCCAGG - Intergenic
997444663 5:133932564-133932586 AGAGCTTTAACGTGTCTTCCTGG + Intergenic
1000853837 5:166374208-166374230 CCTGCTCTAATTTGTGTTCCTGG + Intergenic
1000955899 5:167543104-167543126 TCTGCTCTAAGCTGGCTTCCAGG + Intronic
1001451350 5:171827070-171827092 CGTGCTCTGACCTGACGTGCTGG - Intergenic
1002192388 5:177485099-177485121 CGTGATCTAACATTACTTCCAGG + Intronic
1003729982 6:8810518-8810540 CATGATCTACCCTGGCTTCCTGG + Intergenic
1007321019 6:41028722-41028744 CCTGCTCTTGCCTGCCTTCCAGG + Intronic
1013934429 6:115576513-115576535 CGGGCTCAAGCCAGTCTTCCTGG - Intergenic
1014946969 6:127510416-127510438 CAAGCTCTACCCTTTCTTCCTGG + Intronic
1015163352 6:130177100-130177122 TGTGCTCTAACAGGTCCTCCAGG - Intronic
1019238915 6:170648768-170648790 AGTGGTCTAACCTTTTTTCCAGG + Intergenic
1027624216 7:80527898-80527920 GGTGCTGTAACCTTTCTACCTGG - Intronic
1030477170 7:110050366-110050388 CTTTCTCTAATGTGTCTTCCAGG - Intergenic
1033520519 7:142155756-142155778 CGTGCTTAAACCTAGCTTCCTGG - Intronic
1035570594 8:670096-670118 CTTTCTTTCACCTGTCTTCCTGG + Intronic
1044417780 8:91955543-91955565 GCTTCTCTAACTTGTCTTCCTGG - Intronic
1048110473 8:131462382-131462404 TGTGCTCTCTCCTATCTTCCTGG + Intergenic
1053385337 9:37682697-37682719 CATGCTTTAACCAGTCTTCCAGG + Intronic
1054720903 9:68602787-68602809 TGTGCTCTAACTTGTCTTGCAGG - Intergenic
1055835214 9:80431878-80431900 AGTGCTCTAGACTTTCTTCCAGG + Intergenic
1058115087 9:101076192-101076214 CGTGTTCTAACCAACCTTCCAGG + Intronic
1058160379 9:101564082-101564104 TTTGCTCTTACCTGTCTTCTAGG - Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1185579689 X:1202453-1202475 CGTGTTCTGACCTGTCCTACGGG - Exonic
1189192426 X:39122178-39122200 TGTGCTCTACACTGTCTCCCAGG - Intergenic
1190732853 X:53236148-53236170 CCTGCTCTGACCTGGCTCCCAGG + Intronic
1191818562 X:65275638-65275660 AGTGCACTCACCTTTCTTCCAGG - Intergenic
1192239048 X:69315028-69315050 CTTGCTCCAGCCTGTCTCCCGGG + Intergenic
1195696197 X:107669428-107669450 CGTGCCCTATCCTCTCTGCCAGG + Intergenic
1197690964 X:129500965-129500987 TGTGATATAACCTGTCTTCCAGG - Intronic
1197874400 X:131088325-131088347 CGCCCTCTTACCTGTCTCCCTGG + Intronic
1198087437 X:133294178-133294200 CGAGCTCTGAGCTGTCTTGCAGG - Intergenic
1200077164 X:153556895-153556917 CCTGCCCTGATCTGTCTTCCAGG + Exonic
1201035850 Y:9784402-9784424 TGTACTCTCACCTGTCTTCTAGG + Intergenic