ID: 1088624909

View in Genome Browser
Species Human (GRCh38)
Location 11:111723079-111723101
Sequence GGCACACATGATAGTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088624909_1088624915 5 Left 1088624909 11:111723079-111723101 CCTCCCTTACTATCATGTGTGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1088624915 11:111723107-111723129 CCTCGCTAGTAGAAGCAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1088624909_1088624916 11 Left 1088624909 11:111723079-111723101 CCTCCCTTACTATCATGTGTGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1088624916 11:111723113-111723135 TAGTAGAAGCAGCTTGGCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088624909 Original CRISPR GGCACACATGATAGTAAGGG AGG (reversed) Intronic