ID: 1088625500

View in Genome Browser
Species Human (GRCh38)
Location 11:111727501-111727523
Sequence CTGCATTTTGATGGGGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088625491_1088625500 12 Left 1088625491 11:111727466-111727488 CCTTCCCAACTCTGGTGCTGGAG 0: 1
1: 0
2: 2
3: 25
4: 237
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625492_1088625500 8 Left 1088625492 11:111727470-111727492 CCCAACTCTGGTGCTGGAGTAAT 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625490_1088625500 13 Left 1088625490 11:111727465-111727487 CCCTTCCCAACTCTGGTGCTGGA 0: 1
1: 0
2: 3
3: 15
4: 240
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625493_1088625500 7 Left 1088625493 11:111727471-111727493 CCAACTCTGGTGCTGGAGTAATG 0: 1
1: 0
2: 1
3: 3
4: 115
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625485_1088625500 29 Left 1088625485 11:111727449-111727471 CCCTTGCCTCTTGTGTCCCTTCC 0: 1
1: 0
2: 1
3: 41
4: 539
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625486_1088625500 28 Left 1088625486 11:111727450-111727472 CCTTGCCTCTTGTGTCCCTTCCC 0: 1
1: 0
2: 6
3: 60
4: 602
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239
1088625487_1088625500 23 Left 1088625487 11:111727455-111727477 CCTCTTGTGTCCCTTCCCAACTC 0: 1
1: 0
2: 0
3: 40
4: 365
Right 1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088625500 Original CRISPR CTGCATTTTGATGGGGAGCA AGG Exonic
901198221 1:7452115-7452137 CTGAAATTTGATGGGGAACCAGG - Intronic
901723064 1:11215985-11216007 CTGGATTTTGAGGGGGAGGAAGG - Intronic
903391988 1:22971218-22971240 CTGCATTTTGAGGAGGAGGGGGG - Intergenic
905042761 1:34973825-34973847 CTGCATTCTAATTGTGAGCATGG - Intergenic
907517730 1:55003524-55003546 CTCCATTCTGATGGGGAGAAGGG - Intronic
907952318 1:59195726-59195748 CTACATTTTGATGGGAAGGCAGG + Intergenic
909304361 1:74054005-74054027 ATTCATTTTGATGGGTACCAAGG - Intronic
910017157 1:82539803-82539825 CTGCACTCTGACAGGGAGCATGG - Intergenic
911118078 1:94266583-94266605 CTGCATTGTGGTGGGGCTCAGGG + Intronic
912251858 1:108020192-108020214 CTGCAGGATGATGGGGAACATGG + Intergenic
913099881 1:115553456-115553478 CTGAAATGTGCTGGGGAGCAGGG - Intergenic
914777633 1:150752609-150752631 CTTCCTTTTGGTGGAGAGCAAGG - Intronic
914850066 1:151307715-151307737 CTGCTCTTTGGTGGGGAGCGTGG + Exonic
915956781 1:160227051-160227073 GTGCATTTTTCTGGGGAGAAGGG - Intronic
916367597 1:164050470-164050492 CTTCTTTTTGATGGGGAAGATGG + Intergenic
918144483 1:181743492-181743514 CTGACTTTGGTTGGGGAGCAGGG - Intronic
918338972 1:183551686-183551708 CTGGATTTTTATGGGGAGTGGGG + Intronic
923261767 1:232274413-232274435 CGGCATGTTGATTGGTAGCAAGG + Intergenic
923649333 1:235858842-235858864 CTGCATTGTTATGGGGGGCAGGG + Intronic
924246254 1:242087917-242087939 CTGTATTTTTAAGGGTAGCATGG - Exonic
924799649 1:247318927-247318949 CTGCATTATAATGGGGAAGAAGG + Intronic
1062925019 10:1309740-1309762 CTGGATTTTGATGGGAGGGAGGG + Intronic
1066121793 10:32296385-32296407 GTGTATTTTGATGCGAAGCAAGG - Intronic
1067232930 10:44424719-44424741 CTGCCTTCTGATGAGGAGCTGGG + Intergenic
1068561320 10:58517689-58517711 CTACATTTTAATAGGGAGCTTGG + Intronic
1070301364 10:75206153-75206175 CAGTATTTTTGTGGGGAGCAGGG - Intergenic
1071749672 10:88460560-88460582 CTTTATTCTGATGGGGAGGAGGG - Intronic
1072547630 10:96452121-96452143 CTGCATTCTGATGGAGGGGATGG + Intronic
1074551580 10:114448021-114448043 CTGCATCTAGATGGGAATCAGGG + Intronic
1075406947 10:122201368-122201390 CTGCATTCACATGGGGAGGACGG + Intronic
1077929735 11:6718588-6718610 CTGCCTCTTGATGGGGGGCATGG - Intergenic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1079415061 11:20226467-20226489 CTGCATTTTCTTGGTGGGCAGGG + Intergenic
1080197702 11:29631547-29631569 CTGGATATTGATTGGGAGCAAGG + Intergenic
1083771841 11:64871914-64871936 TGGCGTTTTGATTGGGAGCAAGG - Intronic
1083902254 11:65649351-65649373 CTGCTTTGTGGTGGGCAGCAGGG - Exonic
1084961379 11:72718504-72718526 CTGCATTTTGAGGTGGAGGTGGG - Intronic
1086442090 11:86838393-86838415 CTGCAGCTTGATGGGGAGAGGGG + Intronic
1086601109 11:88635004-88635026 CTGAATTTTGGTGGGGAGGAAGG + Intronic
1087449706 11:98303811-98303833 TTGCATTTTGAGAGAGAGCAAGG - Intergenic
1087606110 11:100380626-100380648 CTGGATTTTGAAGGGCAGGAAGG - Intergenic
1088376158 11:109143889-109143911 CTGCACTTTTATGAGGATCAGGG - Intergenic
1088389679 11:109300314-109300336 CTGACATTTGATGGGGGGCATGG + Intergenic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1088756253 11:112887689-112887711 CTGCTTTTTGATGGGGATTAGGG - Intergenic
1089040656 11:115446200-115446222 CTGTATTCTGATGAGGAGTAAGG - Intronic
1089134297 11:116237022-116237044 CAGGATGTTGATGGGCAGCACGG + Intergenic
1089295186 11:117463136-117463158 CTCCCTTTTGCTTGGGAGCAAGG - Intronic
1089584395 11:119501207-119501229 CTGCATTTTGATAGGAAGGCTGG - Intergenic
1089690448 11:120183789-120183811 CTGCATGATGATGGGGATGATGG - Intronic
1089699325 11:120235014-120235036 CTGGTCTTTGATGGGGAGCAGGG + Intergenic
1091248573 11:134121852-134121874 CTGAATTTTGTTTGGGAGGAGGG - Intronic
1093736316 12:22624862-22624884 CTGAATTTTTCTGGGAAGCAAGG - Intergenic
1093919824 12:24847274-24847296 ATTCATTTGGATGGGGAGAAAGG - Intronic
1094165297 12:27436965-27436987 CTGTACTTTGATGGTGAACATGG - Intergenic
1101014939 12:100490587-100490609 CTAAATTTTGATGGGGAGTGGGG + Intronic
1101264315 12:103067380-103067402 CTTCAGGATGATGGGGAGCATGG - Intergenic
1108228111 13:48311025-48311047 CTGCATCTTGATTGGTAGTATGG + Intronic
1108554112 13:51576391-51576413 GGGCATTCTGATGGGGATCAAGG - Intergenic
1108779556 13:53812713-53812735 TTCAATTTTGATGGGGAGAAGGG - Intergenic
1109153780 13:58878379-58878401 CTCCATTTTGAATGGGAGCTGGG - Intergenic
1110377338 13:74807776-74807798 CTTCAGGGTGATGGGGAGCATGG - Intergenic
1113463254 13:110496282-110496304 CTGGCTTTTGCTGGGGTGCAGGG + Intronic
1115052046 14:29074442-29074464 CTGAATTTTGATGAGGAGACAGG - Intergenic
1115130856 14:30050527-30050549 CTTCAGGTTGATGGGGAACATGG - Intronic
1116593424 14:46809151-46809173 CTGCATTTTGAATAGGAGCTGGG - Intergenic
1116861180 14:49996883-49996905 TGGCATTTTGTTTGGGAGCAAGG + Intronic
1118016800 14:61668959-61668981 CTGTATTTTGAAGGGCAGCTTGG + Intergenic
1119005119 14:70918693-70918715 CTGCATTTTGCAGAGGAGAATGG + Intronic
1119107378 14:71937578-71937600 CTTCAGGATGATGGGGAGCATGG + Intronic
1120389029 14:83882005-83882027 ATGCATTTTGAAAGGGAGAAGGG - Intergenic
1121095517 14:91215651-91215673 CTGGCTTTTGAGGGGCAGCAGGG - Intronic
1121658459 14:95616191-95616213 CTGAATTTTGATGAGGGGAAGGG - Intergenic
1122790670 14:104182961-104182983 CTGCTTCTTGCTGGGGAGCCTGG + Intergenic
1122940876 14:104980865-104980887 CTTCATTTGGATGGGGACCCAGG - Intergenic
1123780031 15:23617192-23617214 CTGCATTTTGAAGAGAATCAAGG + Intronic
1124035614 15:26051322-26051344 CTGCTTTTTGCTGGGTAGCCAGG - Intergenic
1126891927 15:53215649-53215671 CTGCAGTTTTATGGGAAGCCAGG + Intergenic
1127394233 15:58530593-58530615 CTACATCTTGATGGTGATCATGG - Intronic
1127857251 15:62962732-62962754 CTTCAGTCTGATGGGGACCAAGG - Intergenic
1129922677 15:79333363-79333385 TTGCAGTTTGGTGGTGAGCAGGG - Intronic
1131068523 15:89449359-89449381 CTGCATATCGATGGGCGGCAGGG + Intergenic
1131858475 15:96625476-96625498 CTGCATTTTGATGGCTGGAAGGG + Intergenic
1132577391 16:670308-670330 CTGGCTCATGATGGGGAGCACGG - Exonic
1134034861 16:11022019-11022041 CTGAATTTTGGTGGAGAGAAGGG + Intronic
1134383910 16:13754066-13754088 GTGCATGTTTATGGGGAACATGG - Intergenic
1134604001 16:15555718-15555740 CAGCATCTTGCTGGGGACCAAGG - Intronic
1134906093 16:17981098-17981120 CTGCATTTGGAAGGGGTGAATGG - Intergenic
1135876516 16:26205450-26205472 CGGCATTTTGGTCGGGAACACGG - Intergenic
1140282023 16:73563696-73563718 CTGCATTTTGACAGGTAGAAGGG - Intergenic
1140790168 16:78383958-78383980 CTTTATTTTGAAGGGAAGCAGGG + Intronic
1145988902 17:29066283-29066305 CTGATTTCTGCTGGGGAGCAAGG + Intergenic
1146553040 17:33798565-33798587 TGGCATCTTGATGGGGAGTAGGG + Intronic
1146674226 17:34761714-34761736 CTGCATTTTCAAGGTGAGGAAGG - Intergenic
1150849092 17:68687395-68687417 CTCCATTTTTGTGGGGATCAGGG - Intergenic
1151151521 17:72091983-72092005 GTGCATGTTGAGGGGGAGAAAGG - Intergenic
1151459396 17:74245719-74245741 CTGCATTTTAATAGGAAGCCGGG + Intronic
1152521852 17:80861066-80861088 CTGTAGTTTAATGGGTAGCAGGG - Intronic
1153474279 18:5481093-5481115 ATGCTTTGTGATGGAGAGCAGGG - Intronic
1154121671 18:11657461-11657483 CTGCCTTTTGATAGGAAGAAAGG - Intergenic
1155076138 18:22357213-22357235 CCTCATGTTGATGGGGAGCCCGG - Intergenic
1155732870 18:29183317-29183339 TTACATTTTGATGAGGAGCAGGG - Intergenic
1158090768 18:53710363-53710385 TTGTTTTTTGAGGGGGAGCATGG + Intergenic
1158206681 18:55000752-55000774 CTACTTGTGGATGGGGAGCATGG - Intergenic
1159224468 18:65514247-65514269 CTGGATTGAGAAGGGGAGCAGGG + Intergenic
1159641387 18:70866425-70866447 CTACAGTTTGGAGGGGAGCAAGG - Intergenic
1162079129 19:8208629-8208651 CTGCGATTTGGTGGGGTGCAGGG - Intronic
1163142693 19:15361094-15361116 CTGCCTTTCTATGGGGAGTATGG + Intronic
1163249466 19:16117872-16117894 CTGCAGGGTGTTGGGGAGCAAGG + Intronic
1163279936 19:16309673-16309695 GTCCATTTTGATGGGGAGAGTGG - Intergenic
1166459137 19:42970658-42970680 CTGCATCTTGAATAGGAGCAGGG + Intronic
1166476085 19:43125925-43125947 CTGCATCTTGAATAGGAGCAGGG + Intronic
1166918474 19:46212324-46212346 CTGTATCTTTCTGGGGAGCATGG - Intergenic
1166946363 19:46399305-46399327 CTGCATTTTCATTGGTTGCAGGG + Intergenic
926284779 2:11480320-11480342 TTACATTTAGGTGGGGAGCAGGG + Intergenic
926958306 2:18326774-18326796 CTGCATATGCCTGGGGAGCAAGG + Intronic
927184860 2:20474696-20474718 CTGCAGTGGGCTGGGGAGCAGGG + Intergenic
929805448 2:45140865-45140887 CTGCACTTGGGTGTGGAGCATGG + Intergenic
930480997 2:51948007-51948029 CTGCAGTATTATGGGGAACATGG + Intergenic
930990753 2:57650933-57650955 CTGCATTATGTTGGGGAGCTGGG + Intergenic
931229125 2:60359161-60359183 ATTCATATTGATGGGGAGGAAGG + Intergenic
936235797 2:110741461-110741483 CTGAATTTTTAGGGGGAGCGGGG + Intronic
937337850 2:121072686-121072708 CTCCAGAGTGATGGGGAGCAGGG + Intergenic
937434752 2:121871162-121871184 CTGCATCCAGATTGGGAGCAGGG - Intergenic
939493776 2:142904996-142905018 ATGCATCTTGATGGGCAGCCAGG - Intronic
942319015 2:174719623-174719645 GTGCATTTTTCTGGGGAACAAGG - Intergenic
943016095 2:182512187-182512209 CAACATTCTGATGGGGAGAAAGG - Intronic
944783947 2:203048466-203048488 CTGATTTTTGATGGGGAGGGAGG + Intronic
945468495 2:210199741-210199763 ATTCATTTTTGTGGGGAGCAGGG + Intronic
946069915 2:217025234-217025256 TTGCATTTTGATGTGGAGAGGGG - Intergenic
946089613 2:217209116-217209138 GTGCCTGTTGATAGGGAGCAGGG - Intergenic
946533938 2:220606599-220606621 CTTCAGGATGATGGGGAGCATGG + Intergenic
1168984466 20:2036318-2036340 CTCCATATTGATGGAGAGGATGG + Intergenic
1170056455 20:12210346-12210368 CTGCATTTTGATTTTGATCATGG + Intergenic
1173104734 20:40123235-40123257 ATGAAGTTTGATGGGGAGCCTGG - Intergenic
1173137372 20:40450939-40450961 CTGTATTTTGTTGGGAAGCTGGG - Intergenic
1173710358 20:45150272-45150294 CTGGAGTTTGATGGGGAGTTTGG + Intergenic
1174775247 20:53337755-53337777 CTGCTTTTTGATGTAGAGTAGGG + Intronic
1175802259 20:61807520-61807542 CTGCACCTTGACGGGGAGAAAGG - Intronic
1178949896 21:36977710-36977732 GTGCATTTTGTTGGGGAGTTGGG - Intronic
1179439083 21:41380660-41380682 CTGCATTTGGAGGGGGTGCTGGG - Intronic
1181885139 22:26016027-26016049 CTGCATCTTCATGGGGAACTGGG + Intronic
1185242970 22:49756272-49756294 CTGCACTTGGAGGGGGAACAAGG - Intergenic
952122570 3:30262893-30262915 CTGCACTTTGATGGGAACAAGGG - Intergenic
952304521 3:32134280-32134302 CTGTATTTTTATGGTGTGCATGG - Intronic
952836177 3:37604119-37604141 GTGCAGTGTGATGAGGAGCAGGG - Intronic
953218126 3:40940346-40940368 CTGCATTTTGATTGTGATGATGG - Intergenic
954632818 3:52056355-52056377 CTGGTTTTTCATGGGGAGCGCGG + Exonic
955022014 3:55130821-55130843 GTGCATTTTCCTGGGGAGAAGGG - Intergenic
956070361 3:65443314-65443336 CTGCATTTTCATTAGGAACAAGG - Intronic
958016459 3:87944239-87944261 ATGCATCTTGATGGGGAGCTGGG - Intergenic
958122469 3:89309289-89309311 CAGCATTTTGATACGGAGAAGGG + Intronic
958487511 3:94731212-94731234 CTTCAGTATGATGGGGAACATGG + Intergenic
959585861 3:108024508-108024530 CTGCATTATGATGAGGATCTTGG - Intergenic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
961381781 3:126500232-126500254 CTGGAAGTTGGTGGGGAGCATGG - Intronic
962448679 3:135492944-135492966 CTGTAATCTGATGGAGAGCATGG - Intergenic
963331630 3:143922113-143922135 CTGCAGGATGATGGGGAACATGG + Intergenic
963478187 3:145833362-145833384 CTTCATTTTGTAGGGGATCATGG - Intergenic
965915060 3:173834272-173834294 ATACATTTTGATGGTGGGCATGG + Intronic
966637754 3:182155311-182155333 CTTCAAATTGATGGGGAGAATGG - Intergenic
966686659 3:182703281-182703303 CTTCATTTTGCAGGGGAGCTGGG - Intergenic
968081411 3:195849155-195849177 CTGCATCTTGAATGGGAGCTGGG - Intergenic
969327290 4:6451383-6451405 CTGGATTTTGTTGGGGCTCATGG - Intronic
969616006 4:8252898-8252920 TAGCATTTTGATGGGGAGTGGGG + Intergenic
970629455 4:17924763-17924785 CTTCATGATGATGGGGAACATGG - Intronic
970729668 4:19088293-19088315 CTTCAGGATGATGGGGAGCATGG - Intergenic
971008534 4:22403958-22403980 CTGCATTGTTTTTGGGAGCAAGG - Intronic
971390310 4:26179261-26179283 CTGCATTTTGGTGGGAAGTGAGG + Intronic
972930029 4:44061037-44061059 ATTCCTTTTGATGGGGAGCATGG + Intergenic
975266164 4:72370330-72370352 TTGCAATTTGAAGGGGAGAAGGG - Intronic
975291199 4:72679741-72679763 CTGCAGCTTGATGGGGAGAGGGG + Intergenic
975626684 4:76356864-76356886 CTGCATTAGTATGGGCAGCAAGG + Intronic
976469731 4:85414295-85414317 TTTGATTTTGATTGGGAGCAGGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978296691 4:107213493-107213515 CTACATTTTCATGGGCAGCAAGG + Intronic
981354636 4:143774339-143774361 GTGCCTGGTGATGGGGAGCATGG + Intergenic
984604182 4:181765749-181765771 CTGCATTTTGGTGGTGATGATGG - Intergenic
987025786 5:13925338-13925360 TTGCATTCTGATGGGGGCCAGGG - Intronic
988802186 5:34706937-34706959 CTGCAATTTGATGCGGGGTAGGG - Intronic
989452625 5:41604875-41604897 CTGTATTGTGATGGGGGGCTGGG - Intergenic
991322657 5:65392309-65392331 GAGGATTTTGATGAGGAGCAGGG - Intronic
994291195 5:98030692-98030714 CTTCAGTATGATGGGGAACATGG + Intergenic
996917323 5:128727855-128727877 TTGCCTTTTGATTGGGACCAAGG - Intronic
997263294 5:132479917-132479939 CTCCATTGTGATGGGGGCCAGGG + Intergenic
997836552 5:137198887-137198909 ATGTATTTTGGTGGGTAGCATGG + Intronic
998303094 5:141045327-141045349 CTACATATTGAAGCGGAGCATGG - Intergenic
1001234882 5:170021261-170021283 CTGCCTTTTAAGTGGGAGCAAGG + Intronic
1004477663 6:15988880-15988902 CAGCATTTTGAAGAGAAGCATGG + Intergenic
1005066770 6:21825954-21825976 ATGAATTTTGATGGGGAAAAGGG + Intergenic
1005311184 6:24560889-24560911 CTATATTTTGGTGGGGGGCAGGG + Intronic
1006466292 6:34196721-34196743 CTGCATTGTGAAAGGGAGCGGGG + Intergenic
1006714766 6:36109984-36110006 ATTCCTTTTGATGGGGAGAAAGG + Exonic
1008833760 6:55801907-55801929 CATCCTTTTGATGGGAAGCATGG - Intronic
1012344756 6:98171547-98171569 CTGCTTCTGGATGGGGAACATGG - Intergenic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015468359 6:133573849-133573871 CTGTAGTTTGCTGGAGAGCAAGG + Intergenic
1016971271 6:149766496-149766518 CTTCATTATGATGTGGAACATGG + Intronic
1017078200 6:150639670-150639692 CTACATAGTGATGGGGACCATGG + Intronic
1017329941 6:153185183-153185205 CTGCATATTTATGGGAAACAAGG + Intergenic
1017646221 6:156542116-156542138 CTGCAGATAGATGGGGAGGATGG + Intergenic
1018106431 6:160491820-160491842 CTGAATGTTCATGGGGATCACGG + Intergenic
1019113435 6:169737584-169737606 CTGCAGTTTGCTGGGGTGAATGG + Intergenic
1021149093 7:17127726-17127748 CTGCTTTTTGTTGGGCACCAAGG + Intergenic
1021974196 7:25995818-25995840 CAGCCTCTTGATGGGGAGCAGGG + Intergenic
1022777003 7:33537176-33537198 CTGCAATTTAATAGGGAACATGG - Intronic
1022808253 7:33844486-33844508 CTGCATGGTGAGGAGGAGCAGGG - Intergenic
1023470004 7:40507503-40507525 CTGAATGTGGATGGGTAGCAGGG - Intronic
1024110257 7:46137857-46137879 CTGTATTTTGAATGGGAGGATGG - Intergenic
1024645673 7:51368524-51368546 CTGCATTTTGAGGCAGGGCAAGG + Intergenic
1024939381 7:54746275-54746297 GTGGATTCTGATGGGCAGCATGG - Intergenic
1027406881 7:77871746-77871768 CTTCAGAATGATGGGGAGCATGG + Intronic
1028148454 7:87345360-87345382 CTGCATGATGCTGGGGAGCTTGG - Intergenic
1028491549 7:91417907-91417929 CTGCATTAAGATGGAGACCAGGG - Intergenic
1029275814 7:99403764-99403786 CTGCGTTAGGAAGGGGAGCAGGG - Intronic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1030627871 7:111863415-111863437 CTGCAGTTTGATGGCCTGCAGGG + Exonic
1035287813 7:157817254-157817276 CTGCATTTTGCTGGTGCGCTGGG + Intronic
1035457141 7:159015966-159015988 GTTCATTTTGAGAGGGAGCAGGG + Intergenic
1035574400 8:695775-695797 GTGCAGGTTGATGGGGAGGAAGG - Intronic
1037710547 8:21351904-21351926 CTGCACTTTGGTGGAGAGAAGGG + Intergenic
1038266124 8:26041089-26041111 CTGCCTTTTGATGGGGAGAAGGG - Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1039075601 8:33688204-33688226 ATGAATTTTGGTGGGGGGCATGG + Intergenic
1039237812 8:35522070-35522092 ATGTTTGTTGATGGGGAGCATGG - Intronic
1040007596 8:42633097-42633119 CTGCATTGTGCTGAGGAGCAAGG + Intergenic
1041694937 8:60725915-60725937 CTTCCTTTAGGTGGGGAGCAGGG + Intronic
1042812905 8:72845781-72845803 CTGGAGTTTGATGGGGGGGAGGG - Intronic
1044113810 8:88309380-88309402 ATGCATTTTTATGGGAAGGAAGG + Intronic
1044204859 8:89481585-89481607 ATCCATTTTTATGGGGAGGAAGG + Intergenic
1044349419 8:91146253-91146275 CTCCATTTTGAAGGTAAGCAAGG - Intronic
1046346915 8:112941858-112941880 CTGTATTATGATGGGGAGAGAGG - Intronic
1047779875 8:128102414-128102436 GTGCATCCTGATGGGCAGCAGGG - Intergenic
1048270361 8:133023309-133023331 ATTTTTTTTGATGGGGAGCAGGG + Intronic
1049783746 8:144440688-144440710 CTGCATTCGGGCGGGGAGCAAGG + Intronic
1055028379 9:71746361-71746383 CTGCATTTTAATGGGTTGGATGG - Intronic
1055275773 9:74613731-74613753 CTGCTTTTTGATGGGGAGAAAGG - Intronic
1055699963 9:78933281-78933303 TTGCATATGGATGGGAAGCAAGG + Intergenic
1058673552 9:107380948-107380970 CTTTATTTTGAAGGGTAGCAGGG - Intergenic
1059384877 9:113956614-113956636 CTACAGTTTGGTGGGGAGCAAGG + Intronic
1060744149 9:126119100-126119122 CTGCATTTTGGCGGGGGGCTGGG + Intergenic
1062660890 9:137632374-137632396 CTGCATTTTCAAGGGGAACTGGG - Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1185923821 X:4124420-4124442 GTGCATTTTGCTGGGAAGGATGG + Intergenic
1186185710 X:7017789-7017811 CTGCATCTTGAATAGGAGCAGGG + Intergenic
1186785718 X:12954590-12954612 CTGAATCTTGATGGGGAGGGTGG + Intergenic
1189105466 X:38230850-38230872 CTTCAGGATGATGGGGAGCATGG - Intronic
1192568468 X:72182680-72182702 CTTCATTTAGCTGGGGAACAGGG + Intronic
1192622548 X:72693655-72693677 CTGCCTTTTCCTGGGGAGGAGGG + Intronic
1192890483 X:75385262-75385284 CTGAATTCTGATGAGGAGAAGGG + Intronic
1194140674 X:90204921-90204943 CTTCAGGATGATGGGGAGCATGG + Intergenic
1194513260 X:94821003-94821025 CTTCAGTATGATGGGGAACATGG + Intergenic
1194910868 X:99643011-99643033 CTGCCTTTTGAAAGGGAGTAGGG - Intergenic
1197173010 X:123455386-123455408 TTCCATTTTGATTTGGAGCAAGG - Intronic
1198323692 X:135545092-135545114 CTTCACATTGATGGTGAGCATGG - Intronic
1200486440 Y:3774048-3774070 CTTCAGGATGATGGGGAGCATGG + Intergenic