ID: 1088627768

View in Genome Browser
Species Human (GRCh38)
Location 11:111744023-111744045
Sequence CTGTGTAAGTGGAGAGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088627762_1088627768 8 Left 1088627762 11:111743992-111744014 CCTTGACTGGGCAGTGAAGATTT 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG 0: 1
1: 0
2: 0
3: 27
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088627768 Original CRISPR CTGTGTAAGTGGAGAGAAGC GGG Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901254131 1:7806379-7806401 CTGTGTATGTGAAGTGAAGTAGG - Intronic
902214553 1:14925842-14925864 GTGTGTAACTGGGGAGAAGGTGG - Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902406050 1:16184265-16184287 TTGTGGAACTGGAGAGAGGCTGG + Intergenic
903984476 1:27215813-27215835 CTGGGAAAGGGGAGAGAAGGAGG - Intergenic
905938913 1:41847219-41847241 CTGTTTAGGTGGAGAAAAGTTGG + Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908669842 1:66533950-66533972 CTGTGTATTTGGTGACAAGCGGG + Intronic
908696563 1:66849053-66849075 CAGTGTCAGTGGAGACCAGCTGG + Intronic
910240177 1:85078107-85078129 TTGTCTATGTGTAGAGAAGCAGG + Intronic
914395946 1:147268635-147268657 CTGTGTAATTGGTGTTAAGCAGG + Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
916217226 1:162407619-162407641 CTGTGTCAGTGAAGACAAGCAGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920666626 1:207967492-207967514 ATGTGTAATTGGAGAGATGGGGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
922911092 1:229217807-229217829 CTGTGTCAGTGAAGAGACCCAGG + Intergenic
923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
924940522 1:248810229-248810251 CAGGGCAAGTGTAGAGAAGCAGG - Intergenic
1063594925 10:7425804-7425826 CATTGTAAGTAGAGAGAAACAGG + Intergenic
1065029127 10:21567514-21567536 CTGTGTCAGTGGAGAAAAGTAGG - Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067657417 10:48206764-48206786 CGGTTTCAGTGGAGAGAAACCGG - Exonic
1067716215 10:48692926-48692948 GTTTGAAAGTGGAGAGGAGCAGG + Intronic
1068356508 10:55916734-55916756 CTGGGTCAGGGGAGAGAAGGAGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069080094 10:64079454-64079476 TTGACTAAGTGGAGAGAAGAGGG + Intergenic
1070606016 10:77898992-77899014 CTGAGTACGTGGAGAGTGGCAGG - Intronic
1071063400 10:81600885-81600907 ATGTGTATGTCTAGAGAAGCAGG - Intergenic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1074223920 10:111464732-111464754 CTGTGTAACTGGAGTGCAGGAGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075804298 10:125174374-125174396 ATGTGTAAATGCAGTGAAGCCGG - Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077914651 11:6603532-6603554 CTGTGCACGTGGAGAAGAGCGGG - Exonic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1078786240 11:14497007-14497029 TTGTGTAAGTTGAGAGATGGGGG - Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1084991902 11:72933696-72933718 CTGTTTAATTGAAGAGAACCAGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1090416229 11:126542361-126542383 CTTTGTTAGTGGAGAAGAGCAGG + Intronic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1091113595 11:132993983-132994005 CTGCGGAGGTGGAGAGATGCGGG - Intronic
1091416488 12:291395-291417 AGGTGTTAGTGGAGAGAACCTGG + Intronic
1091869942 12:3881109-3881131 CGGAGTAAGTGGTGAGATGCAGG + Intergenic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093286789 12:17273572-17273594 CAGGGTAAGTGGAGAGAATGGGG - Intergenic
1094137415 12:27143243-27143265 CTTTGTAAAAAGAGAGAAGCTGG + Intergenic
1094186867 12:27653283-27653305 CTTTGTAAAAAGAGAGAAGCTGG + Intronic
1095351896 12:41223390-41223412 CTGGGTAGGGGGAGAGAAGGAGG - Intronic
1098969113 12:76830783-76830805 ATGTGTAAGTGGCAAGAAGCAGG + Intronic
1099763293 12:86947784-86947806 TTATGAAAGTGAAGAGAAGCAGG - Intergenic
1099903900 12:88748749-88748771 CAGTGAAAGAGGTGAGAAGCTGG + Intergenic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1101376787 12:104178164-104178186 CTGGGTAATTAGAGAGGAGCTGG - Intergenic
1102427892 12:112858795-112858817 CTCTGGAGGTGGTGAGAAGCAGG - Intronic
1102478964 12:113207729-113207751 CTGCATAAGTGGTGAGAGGCTGG + Exonic
1103746357 12:123127230-123127252 CGGTGTAAGTGGCGTGATGCAGG - Intronic
1104090851 12:125516560-125516582 CTGGGAAATTGGAGAGGAGCAGG + Intronic
1107072415 13:36285696-36285718 CTCTGTAAGTGGCAAGCAGCCGG - Intronic
1109208216 13:59505246-59505268 CTGTGAAAGATGATAGAAGCAGG + Intergenic
1109247707 13:59976710-59976732 CTGTGGAAGATGAGACAAGCAGG - Intronic
1110440456 13:75520396-75520418 CTTTGGAACTGGACAGAAGCTGG + Intergenic
1114967375 14:27979794-27979816 CTGTTGAAGTGGAGAGCATCAGG + Intergenic
1115414975 14:33121784-33121806 ATGTTCAATTGGAGAGAAGCTGG + Intronic
1115669145 14:35589262-35589284 GTTTGAAAATGGAGAGAAGCTGG + Intronic
1118289382 14:64505303-64505325 AGCTGTAAGTTGAGAGAAGCGGG - Intronic
1119228302 14:72960791-72960813 TTGTGTATGTGAAGAAAAGCTGG - Intergenic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119601767 14:75981448-75981470 GTGAGTAGGTGGGGAGAAGCAGG + Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1123629326 15:22250220-22250242 CTGGGTAAGAGAAAAGAAGCAGG + Intergenic
1123877769 15:24640995-24641017 TTCTGTAAGTGGTGAGCAGCTGG + Intergenic
1125350372 15:38760441-38760463 CTATGAAAGTGTAGAGAAGATGG + Intergenic
1125672569 15:41484683-41484705 GGGTGCAAGTGGAGAGAAGAAGG + Intergenic
1127373419 15:58360902-58360924 CTGAGTAAGTGGACAGAAAGGGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128349665 15:66880543-66880565 CTGGCCAAGTGGGGAGAAGCTGG - Intergenic
1129614035 15:77083943-77083965 CTGAGTGATCGGAGAGAAGCCGG - Intronic
1131056867 15:89380018-89380040 CTGTGTATGTGCAGAGAGACAGG - Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1133409024 16:5552615-5552637 ATTTGTAAGTGTAGAGAAGTTGG + Intergenic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1139225740 16:65232253-65232275 AAGTGAAAGTGGAGAGAGGCTGG + Intergenic
1141083684 16:81076600-81076622 CTGTGTGAGAGTAGAGAAGACGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1143902678 17:10185852-10185874 CTGTGTGAGTGTGGAGAAACAGG + Intronic
1144099946 17:11934262-11934284 CTGTTTAAGTTGAGAGATACGGG + Intronic
1144417423 17:15063991-15064013 ATGTGTATGTGGTGAGAAGGAGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1146595283 17:34162996-34163018 ATTGGAAAGTGGAGAGAAGCCGG - Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1148680673 17:49471798-49471820 CAGTGTAAGTGGAGTGAGACTGG - Intronic
1148856714 17:50582971-50582993 CTGTTCAAGGCGAGAGAAGCTGG + Intronic
1150709073 17:67514526-67514548 CTGTGAAAGTCAAGGGAAGCCGG + Intronic
1152022182 17:77785862-77785884 CTGGGCCAGGGGAGAGAAGCTGG + Intergenic
1153246138 18:3074252-3074274 CTGTGTATGTGGACTGCAGCTGG - Intronic
1153467430 18:5404485-5404507 CTGTGTTAGTGCAGAAAAACTGG - Intronic
1154937313 18:21074438-21074460 CTATGTATGTGTAGAGAAACAGG - Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155805789 18:30169680-30169702 TTGTCTAAGTGGAGAGCAGGAGG + Intergenic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156623271 18:38878459-38878481 CTGTGTAACTGGATAGGAGTGGG + Intergenic
1157760465 18:50260122-50260144 CTGTGTAAGTGCACAGTAGTGGG + Intronic
1157791219 18:50532894-50532916 CTGGGTAAGTGCAGAGGAGGAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1158263778 18:55637405-55637427 CAGTGTACGTGGGGAGAAGCCGG - Intronic
1159937192 18:74378614-74378636 GTCTGCATGTGGAGAGAAGCTGG - Intergenic
1160047470 18:75400317-75400339 CTTTGAAAGGGGAGAGATGCAGG + Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1163202689 19:15779974-15779996 CAGGGACAGTGGAGAGAAGCAGG + Intergenic
1163435531 19:17292953-17292975 GAGTGGAAGTGGAGAGATGCAGG - Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1164922580 19:32100225-32100247 CTTTCTATGTGGTGAGAAGCAGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168577916 19:57528420-57528442 ATGTGTAAATGGAGACAGGCTGG + Intronic
925183472 2:1831672-1831694 CTGGGAAAGTGGCGAGAGGCCGG - Intronic
925453297 2:3990398-3990420 CTGTGAAAGTGGCCAGAAGGCGG - Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
929112025 2:38413097-38413119 ATGGGAATGTGGAGAGAAGCAGG + Intergenic
929887514 2:45892064-45892086 CTGCTTACATGGAGAGAAGCTGG - Intronic
930272284 2:49270863-49270885 ATTTGTAAGTGGAGTGAAGTTGG + Intergenic
930482527 2:51966931-51966953 GTGAGCAAGTGGAGAGTAGCAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931061722 2:58536885-58536907 CTGTTTTAGTGGAGAAAAGCAGG + Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
937025952 2:118697190-118697212 TTGGGTAAGTGGAGAAAAGGAGG + Intergenic
939665421 2:144945532-144945554 CTGGGTAAGTGCAGAGGAGGAGG - Intergenic
940023390 2:149180021-149180043 CTTTGTAACTGGCGAGAAACTGG + Intronic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
941305723 2:163863451-163863473 CTGTGTAATTGGAGAAATCCTGG - Intergenic
941979673 2:171441231-171441253 CTGTGCAGGAGGGGAGAAGCAGG - Intronic
943271339 2:185809722-185809744 GTGTGTAAGTGGAAAGAAAATGG - Intronic
943526444 2:189022300-189022322 GTGTGTACGTGGTGAGAAGGAGG + Intergenic
945045454 2:205777514-205777536 CTGTTTAAGTTGAGAGGAGGAGG + Intronic
947285716 2:228512081-228512103 ATGATTAAGTGGAGAGAAGGAGG + Intergenic
947809843 2:232997442-232997464 CTGTCAAAGTGAAGTGAAGCTGG + Intronic
947851673 2:233293490-233293512 CTAGGTCAGTGGAGAGAAGCTGG + Intronic
947863850 2:233382282-233382304 ATGTTTCAGTGGAAAGAAGCTGG - Intronic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948231134 2:236350539-236350561 CTGTGAAAGGGGAGAGCCGCTGG - Intronic
948777389 2:240296801-240296823 CTGTGTCAGTGCAGAGGACCGGG + Intergenic
1168875016 20:1165332-1165354 CTTGGGAAGTGGAGAGGAGCTGG - Exonic
1170789146 20:19493625-19493647 GTGGGTAAGAGGAGAGAATCTGG + Intronic
1172258601 20:33541455-33541477 CTGAGTAAGGACAGAGAAGCCGG + Intronic
1173130608 20:40389489-40389511 CCGTGTATGTAGAGAGTAGCGGG + Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176239344 20:64068745-64068767 CTGTGGAAGTTGGCAGAAGCAGG - Intronic
1176927453 21:14767162-14767184 CTGAGTAGGGGGAGACAAGCTGG + Intergenic
1177788738 21:25698979-25699001 CTTGCTAAGTGGAGAGAGGCAGG + Intronic
1178455268 21:32744050-32744072 CTGTTTAAATGTAGAGAAGGTGG - Intronic
1178670231 21:34583511-34583533 CTTTGTAAGAGGAGAGAATGTGG + Intronic
1179014382 21:37582860-37582882 CTCTGTAAATGGAGAGAATGGGG - Intergenic
1179899397 21:44381187-44381209 CTGCGGACGAGGAGAGAAGCAGG + Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1183030064 22:35097109-35097131 TTGTGTAGGTGGAGATAAGATGG - Intergenic
1183142969 22:35961635-35961657 GTGTGCAAGGGGAGAGCAGCAGG - Intronic
1183334351 22:37238073-37238095 CTGTGTACTTGGAGTGAAGTGGG + Intronic
1183924275 22:41194873-41194895 CTGTGAAAGGGAAGAGAAGCCGG - Intergenic
1183992199 22:41604973-41604995 CTGAGTAAGTGGACAGCATCAGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
949829516 3:8198969-8198991 GAGGGTAAGTGGAGAGAGGCTGG - Intergenic
950727061 3:14923416-14923438 GTGTGTAAGGGGACAGAGGCAGG + Intronic
951656073 3:25009851-25009873 CAGTGGAAGGGGAGACAAGCAGG + Intergenic
953676682 3:45008026-45008048 GTGTTTAAATGGAGACAAGCAGG + Intronic
953834320 3:46329925-46329947 AAGTGTAAGTGAAGAGAGGCTGG + Intergenic
954693569 3:52408874-52408896 CTGGGTAAGAGAAGAAAAGCTGG + Intronic
955101155 3:55851320-55851342 TAGTTTAAGTGGAGAGAGGCTGG - Intronic
956731838 3:72203730-72203752 GGGTGAAAGTAGAGAGAAGCGGG - Intergenic
957037029 3:75302907-75302929 CCTTATATGTGGAGAGAAGCAGG - Intergenic
958520076 3:95173401-95173423 TTATGTAAGTAGAGAGAATCAGG + Intergenic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
958824842 3:99017722-99017744 CTGTGTAGGTGCAGGGAACCAGG - Intergenic
961062953 3:123847917-123847939 CTGTCTAAGAGGATAGAAACTGG - Intronic
961488144 3:127231971-127231993 CTGGCCAAGGGGAGAGAAGCAGG - Intergenic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962455724 3:135563870-135563892 CTGGGTAAGTGGGGAGAGACAGG - Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964471715 3:157063894-157063916 CTGTGGAAGTGAAGAGACCCAGG + Intergenic
966607256 3:181833961-181833983 CAGTGTCAGTGGAGACATGCCGG - Intergenic
967052408 3:185797044-185797066 CTGGGGAAGTGGGGAGAAACAGG - Intronic
968219433 3:196925110-196925132 TTGGGTAAGTGTAGAAAAGCAGG + Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
972511415 4:39771167-39771189 CCGTGTAGCAGGAGAGAAGCAGG + Intronic
972761166 4:42105876-42105898 CTGTGTGATTGAATAGAAGCAGG - Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
979013500 4:115400983-115401005 CTCTGTAAGTGTAGAGCATCCGG - Intergenic
979683143 4:123483280-123483302 CTGTGAGAGTTTAGAGAAGCAGG - Intergenic
979963610 4:127050880-127050902 TTGTGCAAGTGCAGGGAAGCAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
981543568 4:145871494-145871516 CTGTGAAAGTGAAGAGTAGTAGG - Intronic
981596952 4:146435350-146435372 CTGGCCATGTGGAGAGAAGCAGG - Intronic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
981734120 4:147931635-147931657 CTCTGTATTTGGAGAGAAGGTGG + Intronic
982287189 4:153747732-153747754 CTGTGTAATTGGGCAGAGGCTGG - Intronic
982314253 4:154015419-154015441 CTCTGTAAGTGGAGAGGTGAGGG + Intergenic
982635906 4:157896395-157896417 CTGGGTCAGTGAAGAGAAACAGG - Intergenic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
987065096 5:14281944-14281966 CTGTGTAGGTTGACACAAGCGGG + Intronic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
990254464 5:53951969-53951991 GTGTGAAAGAGGAGAGTAGCTGG + Intronic
991296102 5:65083265-65083287 CTGTGTAAGTGCCCAGAAGCTGG - Intergenic
992102700 5:73422536-73422558 CTGTGTCAGTGCAGTGCAGCTGG + Intergenic
992173307 5:74125029-74125051 CTGAGTAAGTGGACAGACGCAGG - Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994722368 5:103394969-103394991 TTGTCCAAGTGGAGAGAAGCAGG - Intergenic
995936675 5:117524459-117524481 CTTTGAAAATGGAGAGAACCTGG - Intergenic
997870704 5:137502859-137502881 CTGTGGAAGTGGGGTGAAGTGGG - Intronic
998777502 5:145618951-145618973 CAGGGTAAGTGGGGAAAAGCTGG + Intronic
998883232 5:146666644-146666666 CTATGAAAGTGGAGAGGAGATGG - Intronic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1003192233 6:3884473-3884495 ATGTCTAAGTGTACAGAAGCAGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1005628453 6:27685445-27685467 CTCTGTTAGTGTGGAGAAGCAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006870894 6:37250723-37250745 ATGTGTAAGTGTAAAAAAGCTGG + Intronic
1007214421 6:40226298-40226320 CTGTGTATATTGGGAGAAGCGGG + Intergenic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008402448 6:51079414-51079436 CTGTATAAGTGAAGAGAAGTGGG + Intergenic
1008970914 6:57366805-57366827 ATCTGTAAGTGGGGAGCAGCTGG + Intronic
1009159874 6:60268609-60268631 ATCTGTAAGTGGGGAGCAGCTGG + Intergenic
1009409276 6:63346806-63346828 TTTTGAAAGAGGAGAGAAGCTGG + Intergenic
1010180602 6:73082574-73082596 GTGTGTAAGAGATGAGAAGCAGG - Intronic
1010942404 6:81934138-81934160 TTGTGTAAGTGGACAGATGAAGG - Intergenic
1011643332 6:89434363-89434385 CAGTGTAAGTGGAAAGAACTTGG + Intronic
1011986277 6:93450756-93450778 ATATGTAATTGCAGAGAAGCTGG + Intergenic
1012265910 6:97142769-97142791 CTGTGAAAGTACACAGAAGCAGG + Exonic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013680704 6:112522337-112522359 CAGTGTAAGTGAAGAGCAGAGGG - Intergenic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021168129 7:17365453-17365475 CAGAGAAAGTGGAGAGTAGCAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023098652 7:36690078-36690100 ATGTGTAAGTACAAAGAAGCAGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1030165135 7:106547012-106547034 CTGACTAAGGGGAGAGCAGCAGG - Intergenic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1038247106 8:25868902-25868924 ATGTATAAGTGGAGAGAAAGAGG - Intronic
1038389924 8:27187269-27187291 GAGTGAAAGGGGAGAGAAGCAGG + Intergenic
1039631580 8:39117618-39117640 ATGTATAAGGGGAGATAAGCAGG - Intronic
1041677441 8:60549593-60549615 CTGTCTACGTGGAGAGAAAGGGG + Intronic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1042572814 8:70185059-70185081 CTGTGTCTGTAGAGAGAAACTGG - Intronic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1045074085 8:98543212-98543234 CTCTGTAAGAGCTGAGAAGCTGG + Intronic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045530668 8:102982150-102982172 TAGTGTAAGTGGTGAGAAGTTGG + Intergenic
1047725764 8:127682868-127682890 CTGAGCCAGAGGAGAGAAGCTGG - Intergenic
1047954595 8:129964162-129964184 CTTTTTAAGTGAACAGAAGCTGG + Intronic
1048856665 8:138692618-138692640 CTCTATAGGTGCAGAGAAGCAGG + Intronic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1052715927 9:32117074-32117096 ATGTGCATGTGGAGAGAAGATGG - Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1056821617 9:89846054-89846076 GCGTGTAAGGGGAGAGAAACGGG + Intergenic
1057201183 9:93140904-93140926 CTTTGTATGCGGTGAGAAGCAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057851804 9:98571871-98571893 TGGTGCAAGTGGGGAGAAGCAGG - Intronic
1058533354 9:105929174-105929196 GTGTGTAAGTGGATAGAAGAAGG + Intergenic
1058597754 9:106633191-106633213 CATTGTAAGTGGAGAAAAGAAGG - Intergenic
1059180724 9:112209998-112210020 CTCTGTCAGTGCAGAGCAGCTGG + Intergenic
1186733334 X:12433903-12433925 CTTTATAGGTGGAGAGAAGAAGG + Intronic
1186733370 X:12434344-12434366 CTTTATAGGTGGAGAGAAGAAGG - Intronic
1188082278 X:25858845-25858867 CTATGTCAGTAGAGACAAGCTGG + Intergenic
1188451869 X:30316042-30316064 CTGGGTAAATGAAAAGAAGCTGG + Intergenic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1190134124 X:47779444-47779466 CTATGTAAATGGAGACAGGCTGG - Intergenic
1192497334 X:71624663-71624685 CTGTGTAAGGTGAGAGGGGCTGG + Intergenic
1195460303 X:105116100-105116122 CCCTGCAAGTGGAGGGAAGCCGG + Intronic
1196150490 X:112368238-112368260 GTGTGTTAGTGAAGAGAAGGTGG + Intergenic
1199374698 X:147093886-147093908 CTATGTGAGTGGAGAAAACCTGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1201473368 Y:14356973-14356995 AAGTGAAAGTGAAGAGAAGCTGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic