ID: 1088628738

View in Genome Browser
Species Human (GRCh38)
Location 11:111753343-111753365
Sequence TAGAACCCCCAAAAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088628738_1088628742 29 Left 1088628738 11:111753343-111753365 CCATTTTCTTTTTGGGGGTTCTA 0: 1
1: 0
2: 2
3: 26
4: 356
Right 1088628742 11:111753395-111753417 TAAAATCAAATTACTATCAAAGG 0: 1
1: 0
2: 3
3: 51
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088628738 Original CRISPR TAGAACCCCCAAAAAGAAAA TGG (reversed) Intronic
901343859 1:8520896-8520918 AAGCACCCCCAGAAAAAAAAAGG + Intronic
903113719 1:21160790-21160812 TAGAATCCTGAAACAGAAAAAGG + Intronic
903257719 1:22114049-22114071 TAGAACCCTCAAAACAAAGAAGG - Intergenic
903432638 1:23318873-23318895 CAGAACCCCTAAAATTAAAAAGG - Intronic
903573823 1:24325505-24325527 TAAAACCCCCAATAAGACCAAGG - Intronic
904936452 1:34132965-34132987 TAGAACCAAAAAAAAAAAAAAGG - Intronic
907785931 1:57612622-57612644 TAGAGCCTCCAGAAGGAAAATGG + Intronic
907851935 1:58263179-58263201 TACAGCTCCCAAAAAGTAAAAGG - Intronic
910396386 1:86798489-86798511 TAGATACCCAAAAAAAAAAAAGG + Intergenic
911421799 1:97651964-97651986 TTAAGCCCACAAAAAGAAAATGG + Intronic
911786872 1:101962136-101962158 CTGAACTCCCAAAAAGAAAAAGG - Intronic
911795018 1:102064853-102064875 TAGAAAACCCAGAAAAAAAAAGG + Intergenic
912578651 1:110700165-110700187 CATTTCCCCCAAAAAGAAAATGG + Intergenic
912647398 1:111406923-111406945 TAGCACCCACAAAAAAGAAAAGG + Intergenic
912873370 1:113330076-113330098 TAGAACCTCCAAAATATAAACGG - Intergenic
912983902 1:114406208-114406230 AAGTACCCCCATAAAAAAAATGG - Intronic
913155592 1:116093926-116093948 TAGAATGACCAAGAAGAAAAGGG - Intergenic
915114245 1:153585711-153585733 TAAAATCCTCAAAAAGATAAAGG + Intergenic
915939728 1:160111497-160111519 AAGAAAGACCAAAAAGAAAACGG + Intergenic
917148759 1:171922419-171922441 TAAAATCCCCAAAAAGAAATGGG - Intronic
917333121 1:173902900-173902922 AAGAACCGCCAAATTGAAAAAGG + Exonic
917824537 1:178804068-178804090 TAGAAACCAAAAAAAAAAAAAGG - Intronic
918115986 1:181498069-181498091 GAGAACCGGAAAAAAGAAAATGG - Intronic
918166841 1:181957602-181957624 TGGAACCAAAAAAAAGAAAAAGG - Intergenic
918296935 1:183166015-183166037 TGGAACCCCGGAACAGAAAAAGG + Intergenic
919075079 1:192803460-192803482 CAGATCCCCCAAAAAGAATGAGG + Intergenic
920454596 1:206089636-206089658 TAGGGCCCCCAAACAGCAAATGG - Intronic
920875433 1:209830093-209830115 TGGAAACCCTAAAAAGAAACAGG - Exonic
921623125 1:217348583-217348605 TTGAACCATGAAAAAGAAAAGGG - Intergenic
922062066 1:222102287-222102309 TAGAGCACCCAGAAAGAAAGGGG + Intergenic
923663150 1:235976377-235976399 AAGTAACTCCAAAAAGAAAATGG - Exonic
924060813 1:240172572-240172594 AAGCTCCCCCAAAAAGACAAGGG + Intronic
1063005021 10:1961918-1961940 CAGAACCCCCAAAAGGACAGGGG - Intergenic
1066500394 10:35987934-35987956 TGGAGCCCTCATAAAGAAAATGG - Intergenic
1066526656 10:36287196-36287218 TAGATTCCCCAAAACTAAAAAGG - Intergenic
1068512412 10:57983552-57983574 TAGAACCATCAAAAAGAAAGAGG - Intergenic
1068820363 10:61369815-61369837 AAAAACTTCCAAAAAGAAAATGG - Intergenic
1068934951 10:62626576-62626598 AAAAACTCCCAAAATGAAAATGG + Intronic
1069348167 10:67494613-67494635 TAGAACACACAAATAGTAAATGG - Intronic
1070804811 10:79264828-79264850 GGGTACCCCCAAAAAGAAAGGGG + Intronic
1073133129 10:101203583-101203605 TAGAATCCTGAAACAGAAAAGGG + Intergenic
1073570092 10:104573957-104573979 TAGAACAGGCAAAAAGAAACAGG - Intergenic
1075436615 10:122448946-122448968 TAGAAGACTCAAAAACAAAAAGG - Intergenic
1075768400 10:124913242-124913264 TAAAAACCCCAAAAAGACAGTGG + Intergenic
1075932022 10:126306696-126306718 TAGAAACCGCCAGAAGAAAATGG - Intronic
1076092494 10:127699879-127699901 TAGAAGCCGCACAAAGAACATGG + Intergenic
1076195460 10:128514347-128514369 TACAGCCCCCAAAAAATAAAAGG - Intergenic
1077949043 11:6934520-6934542 CATAAGCCCCAGAAAGAAAACGG - Intronic
1078696902 11:13643331-13643353 TAGGATCCTCAAACAGAAAAAGG + Intergenic
1078741505 11:14070815-14070837 TAAACCCTCCAAACAGAAAAGGG + Intronic
1080284063 11:30587526-30587548 TATACCCCCTAAAAATAAAAAGG + Intergenic
1081907792 11:46680342-46680364 TAGAACCCCAAGACAGAGAAGGG - Intronic
1084781471 11:71412462-71412484 TAGAGCCCCCAGAGGGAAAATGG + Intergenic
1086777792 11:90860960-90860982 TAGAACAACTAAAATGAAAAAGG + Intergenic
1086890572 11:92253402-92253424 GAGAACCTCCAAAAAGAAGAGGG - Intergenic
1087077960 11:94142933-94142955 AGGAACCTCAAAAAAGAAAAGGG - Intronic
1087455318 11:98377905-98377927 TAGAAGTACCAAAGAGAAAAAGG + Intergenic
1088628738 11:111753343-111753365 TAGAACCCCCAAAAAGAAAATGG - Intronic
1088766339 11:112983217-112983239 TAAAAACCCCAACAAGAAATTGG - Intronic
1089123714 11:116161432-116161454 AAGAACCACCACTAAGAAAAAGG + Intergenic
1089612521 11:119677455-119677477 AAGCACCCCCAGAAAGAGAAAGG + Intronic
1090931055 11:131298461-131298483 TAGAACCACATAAAAGACAAGGG - Intergenic
1090975394 11:131675834-131675856 TTAAATCCCCTAAAAGAAAATGG + Intronic
1093808202 12:23461360-23461382 TAGAACCCTATAACAGAAAAAGG - Intergenic
1095215569 12:39543454-39543476 TACAATCCCCACAAAGGAAAAGG - Intergenic
1095888219 12:47210827-47210849 AAGAGCACCCTAAAAGAAAAAGG + Intronic
1095901944 12:47336935-47336957 TAAAACACCAAAAAATAAAAAGG - Intergenic
1097756132 12:63408539-63408561 GAGAATCCCCAAAAAATAAATGG - Intergenic
1097984524 12:65769411-65769433 CAGAACCCCAAAGAAGAAAGAGG - Intergenic
1098160718 12:67647027-67647049 TAGAATCGACTAAAAGAAAAGGG - Intergenic
1098206039 12:68110773-68110795 CAGAGTTCCCAAAAAGAAAAGGG + Intergenic
1098584238 12:72137390-72137412 AAGGATCCCTAAAAAGAAAATGG - Intronic
1098731971 12:74047632-74047654 TAGGATCCTCAAATAGAAAAAGG + Intergenic
1098998656 12:77150806-77150828 GAGGATCCCCAAAAAGAAATAGG + Intergenic
1099452896 12:82828937-82828959 TAGTACCCTTAAAACGAAAATGG + Intronic
1104171141 12:126282092-126282114 TAGATTCACCAAAAAGAAACAGG - Intergenic
1107149285 13:37092877-37092899 TAAAAGCCACCAAAAGAAAAAGG - Intergenic
1107686392 13:42904265-42904287 AAAAACAACCAAAAAGAAAAAGG + Intronic
1108493979 13:51006468-51006490 TGGTACCCCCAAAAAGAAGCTGG - Intergenic
1108821316 13:54354277-54354299 CAGAACCCCTCACAAGAAAATGG + Intergenic
1109074356 13:57815422-57815444 CAAAACCCCCAAAACAAAAAAGG + Intergenic
1110058818 13:71015105-71015127 AAAAACCACCAAAAACAAAATGG - Intergenic
1110796998 13:79650639-79650661 TAGGACCCTGAAACAGAAAAAGG - Intergenic
1112055357 13:95685344-95685366 TAAAACCGGCCAAAAGAAAAAGG - Intronic
1112597895 13:100825900-100825922 TAATACCCCCAAAAAGCCAAAGG - Intergenic
1112943804 13:104899289-104899311 TGGAACTCTAAAAAAGAAAAGGG + Intergenic
1113024735 13:105928349-105928371 TAAAATCCCCACAGAGAAAATGG - Intergenic
1114193235 14:20456282-20456304 GAGAACACTAAAAAAGAAAATGG - Intronic
1114254958 14:20993780-20993802 TACAACTCCTAAAAAAAAAAAGG - Intronic
1116148950 14:41112981-41113003 AAGACCCCCCAAAAATACAAGGG + Intergenic
1117192696 14:53308753-53308775 TAGAAGCCCTAAAAACTAAAAGG - Intergenic
1117825204 14:59694833-59694855 GAGAAGCCACAGAAAGAAAAAGG + Intronic
1117896144 14:60489017-60489039 ATGACCCCCAAAAAAGAAAAGGG - Intronic
1119245296 14:73099653-73099675 TATATCCTCCTAAAAGAAAACGG - Exonic
1119949761 14:78732550-78732572 TAGAACCACCAAACAGAAAATGG - Intronic
1120299598 14:82690077-82690099 AAGCATCACCAAAAAGAAAATGG + Intergenic
1120473318 14:84954901-84954923 AAGATGCCCCAAAAAGCAAATGG + Intergenic
1121519139 14:94573927-94573949 TAAAAACCCCAAAAAGGACAGGG - Intronic
1121532079 14:94661798-94661820 TAGAAAACCCAAAAACAAACTGG + Intergenic
1122331421 14:100918132-100918154 TAGAAGCCTCAATATGAAAAAGG + Intergenic
1122589928 14:102841347-102841369 GAGAACCACCAAAAAGGAGAAGG + Intronic
1123129749 14:105975226-105975248 AGGAATCCCCAAAGAGAAAACGG - Intergenic
1123579937 15:21705759-21705781 AGGAATCCCCAAAGAGAAAACGG - Intergenic
1123616585 15:22148381-22148403 AGGAATCCCCAAAGAGAAAACGG - Intergenic
1125983916 15:44030691-44030713 TACAATCCCCAAAAAGGAGAAGG + Intronic
1126345278 15:47687107-47687129 CAGAATTCCCAAAAAGAACATGG + Intronic
1126597145 15:50394300-50394322 TTGAATCCCCAAAATGAAACTGG - Intergenic
1127248250 15:57202214-57202236 TTTAACACTCAAAAAGAAAATGG - Intronic
1127615154 15:60677340-60677362 AACAACCCCCAAAAAGCTAAGGG + Intronic
1129634496 15:77300673-77300695 TAGGACCCTGAAACAGAAAAAGG - Intronic
1129834632 15:78694401-78694423 TAGAATCCGCAAAGGGAAAAGGG - Intronic
1131945316 15:97613911-97613933 AAAAATCCTCAAAAAGAAAACGG + Intergenic
1202988807 15_KI270727v1_random:440004-440026 AGGAATCCCCAAAGAGAAAACGG - Intergenic
1133307502 16:4819952-4819974 TAGAACACCAAGAAAGGAAAGGG - Intronic
1133325275 16:4938184-4938206 TAGAAGCCCCATTAAGAATAAGG - Intronic
1135954478 16:26944821-26944843 TTGAACCCCCAAGAAGAGAAAGG + Intergenic
1136286124 16:29243574-29243596 AAGAACCCCCAGAAAGAGCAAGG - Intergenic
1137986367 16:53111329-53111351 TGGAAACCCCAAAGAGAAAATGG - Intronic
1138021313 16:53484140-53484162 TAACAGCCCCAAAAAGCAAATGG + Intronic
1138717197 16:59037122-59037144 GGGAACCTCCAAAATGAAAAAGG + Intergenic
1138769050 16:59640408-59640430 TAGAAGCCAAAAAAAGAATATGG - Intergenic
1138973233 16:62171140-62171162 GAGAGCCCACAAAAAGAAATTGG - Intergenic
1139287015 16:65824679-65824701 TAGAACCCCAAAGAAGAGAATGG - Intergenic
1139736843 16:68997580-68997602 AAAACCCACCAAAAAGAAAATGG - Intronic
1140606406 16:76544209-76544231 TACAACTCCAAAAAAAAAAAAGG - Intronic
1141842439 16:86581931-86581953 TACAAACACAAAAAAGAAAAAGG - Exonic
1142947608 17:3445967-3445989 TAGAGCCTCCAAAAGGAACATGG - Intronic
1146247282 17:31299127-31299149 TAAAATTCTCAAAAAGAAAAAGG + Intronic
1148712953 17:49695176-49695198 TAGAAGCGCCAAATGGAAAAGGG + Intergenic
1148879755 17:50716841-50716863 TACTACCACCAAAAAAAAAAAGG - Intergenic
1149262658 17:54896681-54896703 TATAGGCCCCACAAAGAAAAAGG - Intergenic
1150661787 17:67087223-67087245 TACTCCCACCAAAAAGAAAAAGG + Intronic
1150886924 17:69097968-69097990 TAGAACCAAAAATAAGAAAAAGG + Exonic
1151266977 17:72964029-72964051 TAGGACCCCCAAAAGTACAAAGG + Intronic
1153000062 18:446773-446795 GAGCACCCCTAAAAACAAAAAGG + Intronic
1154032010 18:10761761-10761783 TAGAAGGTCCACAAAGAAAATGG + Intronic
1155564567 18:27119719-27119741 TTGAACCACTCAAAAGAAAAAGG - Intronic
1155718856 18:28985052-28985074 TATATCCTCCAAAATGAAAAGGG - Intergenic
1155844278 18:30685812-30685834 AAAAACCCCCAAAAAACAAAAGG - Intergenic
1155963414 18:32014746-32014768 CACAACCTCCAAAAACAAAAAGG - Intergenic
1156593878 18:38523477-38523499 TAGAACCCGCAACAGGAAAGTGG + Intergenic
1158094104 18:53750665-53750687 TAGTCCCTCCAATAAGAAAATGG + Intergenic
1158517107 18:58139800-58139822 TAGAACCCCCTAAAAGGGGAGGG + Intronic
1160353727 18:78208318-78208340 AACAATCCACAAAAAGAAAAGGG - Intergenic
1163524493 19:17812351-17812373 TAGCAGCCACAAAAAGAAGATGG - Exonic
1164380163 19:27728453-27728475 TAGAACCTACAAAAAGACATTGG - Intergenic
1165661658 19:37586008-37586030 TAGAACCTCCAGAAGGAACATGG + Intronic
1167782765 19:51610904-51610926 TAGAATGCCTGAAAAGAAAATGG - Intergenic
1168598734 19:57700946-57700968 TAGAACCCCCAAGATTAATAAGG + Exonic
1168647408 19:58068740-58068762 TAGAACCTACAAAAAAGAAATGG + Exonic
925299142 2:2797839-2797861 TAGAGCCCCAAAGAAGAAAATGG + Intergenic
928601816 2:32910851-32910873 TAAAACCCACAAAATGTAAATGG - Intergenic
930929938 2:56869016-56869038 TATAATCCAAAAAAAGAAAAAGG + Intergenic
931183811 2:59930337-59930359 TAGAAATCCCAAAATGACAAGGG - Intergenic
932485524 2:72082082-72082104 TAGAACCCACAACAAAAACATGG + Intergenic
933000860 2:76921097-76921119 TAGAATCCGCAGAAAGAAACAGG - Intronic
933211640 2:79576973-79576995 TAAAACCCCCATGAAGAACATGG - Intronic
933256740 2:80089438-80089460 GAGAACCCCCAAAATGCAAAAGG - Intronic
933383814 2:81584539-81584561 TAAAACCTCTAAAAAGAAAATGG + Intergenic
933732832 2:85470835-85470857 TAAAACCCCTGAAAGGAAAATGG + Intergenic
934108869 2:88723443-88723465 TAAAACTCCAAAAAACAAAAAGG + Intronic
935343931 2:102086536-102086558 TAAAATCCCCAAAAAAAAAGAGG - Intronic
936436364 2:112510086-112510108 TATATCCTCCAAAAAGCAAAAGG - Intronic
937804562 2:126123836-126123858 TGGTACTACCAAAAAGAAAAGGG - Intergenic
940386561 2:153080233-153080255 TACCCACCCCAAAAAGAAAAAGG - Intergenic
940658861 2:156521503-156521525 TTGACCCCCCAAAAATAATACGG - Intronic
941118577 2:161501677-161501699 GAGAAGCCCCAAGAAGAAAGAGG - Intronic
941120069 2:161518497-161518519 AAGAACCTCCAAAATTAAAAAGG - Intronic
944726420 2:202475658-202475680 TAAAAACCCCAACATGAAAAAGG - Intronic
945281405 2:208038853-208038875 TAGAACCCAGAAACAGAAAATGG + Intergenic
945540899 2:211085461-211085483 TAGCACCCCCTAAAAAAAGATGG + Intergenic
946842670 2:223834169-223834191 TATAACCCACATAAACAAAAAGG - Intronic
946917618 2:224541465-224541487 TAGAACTACCATAAACAAAATGG + Intronic
1169901219 20:10553645-10553667 TACAACCCACAATAAGAAATAGG + Intronic
1170218345 20:13915790-13915812 TGCAATCCCCAAAAGGAAAAAGG + Intronic
1171353019 20:24519431-24519453 AAGTACCCACAAAAACAAAATGG - Intronic
1172616641 20:36291738-36291760 TAGTATCCCCAAAATGAAATAGG - Intergenic
1173517582 20:43675741-43675763 CAAAGCCCCCAAAAAGAAAAAGG - Intronic
1174598566 20:51705210-51705232 TACAACTCCAAAAAAGAAAAAGG + Intronic
1175056074 20:56199433-56199455 TAGAGCCTCCAAAAAATAAATGG + Intergenic
1177680285 21:24359273-24359295 CAGAATCCCCCAAAATAAAATGG + Intergenic
1178523886 21:33308627-33308649 AAGATCCCACAAAAAGAATAGGG + Intergenic
1179336834 21:40464478-40464500 TAGAACCCCCATACACACAAAGG + Intronic
1179448631 21:41452311-41452333 TAGAAGCCCCTAAAAGAGAAAGG + Intronic
1181133195 22:20746548-20746570 TACCACCCCCAAAAAGGAAAAGG + Intronic
1183320667 22:37163423-37163445 TAGATACCCCAAAGAGAAATGGG + Intronic
1185007226 22:48288032-48288054 TAGAAAATCCAAAAGGAAAACGG + Intergenic
1203237806 22_KI270732v1_random:22951-22973 TTGAAATCCCAAAAAGAAAAGGG - Intergenic
949760032 3:7459932-7459954 TAGAACCCAAAAACAGGAAATGG + Intronic
949821062 3:8115839-8115861 CAGAAGCCCCAAAGAGAATAAGG + Intergenic
950253045 3:11482792-11482814 TATAAACCTCAAAAAAAAAAAGG - Intronic
950296754 3:11838700-11838722 TGGAACCTCCATAAAAAAAAGGG - Intronic
952247942 3:31617004-31617026 TGATACACCCAAAAAGAAAAGGG - Exonic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955617478 3:60824486-60824508 TAAAATCAACAAAAAGAAAAAGG + Intronic
955897613 3:63717403-63717425 TAGAACCCCCAGGAGGAACACGG - Intergenic
956403997 3:68909171-68909193 CAAACCCCCCAAAAAAAAAAGGG + Intronic
957188432 3:76974022-76974044 CAGAACCACCAAAATTAAAAAGG - Intronic
957453731 3:80414227-80414249 TATAACCCTGAAAAAAAAAATGG + Intergenic
958263940 3:91415073-91415095 TAGGACTCCAAAAAAGAGAATGG + Intergenic
958881202 3:99672847-99672869 TAGAGCTCCACAAAAGAAAATGG - Intronic
959402902 3:105924139-105924161 TAGAACCCACAAAATAAGAATGG + Intergenic
960482960 3:118215557-118215579 TAGAACCCATATTAAGAAAACGG + Intergenic
960497849 3:118396754-118396776 AAGAATCCCCAAATAGATAAAGG + Intergenic
960619145 3:119622483-119622505 AAGAACCCACAAGAAGAAAGGGG - Intronic
961229792 3:125294291-125294313 TTGAATCCTCAAACAGAAAAAGG + Intronic
963071928 3:141311710-141311732 TAGAACCCGCAACAGGAAAACGG + Intergenic
963307769 3:143672954-143672976 TAGTAACCCCAAATAGAAAGGGG + Intronic
963423564 3:145093910-145093932 TAGAACCTCCAAAAGGAATGTGG + Intergenic
963487923 3:145960008-145960030 TGAAACCCACAAAAAAAAAATGG + Intergenic
963765076 3:149326222-149326244 TAACACCCCAAAAAACAAAAAGG - Intronic
963956910 3:151264054-151264076 TAGAACTACTCAAAAGAAAAAGG - Intronic
964244891 3:154640336-154640358 TAGAAGCTTCAAAAAGCAAATGG - Intergenic
965041656 3:163516816-163516838 TAGAGCAGACAAAAAGAAAAAGG + Intergenic
966992740 3:185250666-185250688 TAAAACCCCAAGAAATAAAAAGG + Intronic
967194898 3:187017569-187017591 TGGACCCCCTACAAAGAAAAAGG - Intronic
967661230 3:192112869-192112891 TGGCACACCCAAAAAGAACATGG + Intergenic
968052722 3:195666534-195666556 TAGAACCCACTAAAACAAGAGGG - Intergenic
968103087 3:195981818-195981840 TAGAACCCACTAAAACAAGAGGG + Intergenic
969264013 4:6052676-6052698 CAGAACCACCAGAAACAAAATGG - Intronic
970900435 4:21152501-21152523 TAGAAACCAAAAAAAAAAAATGG - Intronic
971216663 4:24668371-24668393 TAGAAGCACCAAAGAGAAGAAGG - Intergenic
971335821 4:25723201-25723223 GATAACACCCAAAAAGATAAGGG - Intergenic
971539321 4:27795938-27795960 TAGACCCCCCCTAAACAAAATGG + Intergenic
972992849 4:44843652-44843674 GAGAACTCCCAAATAGACAACGG + Intergenic
973638188 4:52879002-52879024 AACAACCCCCAAAAAGGAACAGG - Intronic
973824685 4:54693341-54693363 AAGAACCACCAGGAAGAAAAGGG - Intronic
974028976 4:56758834-56758856 TGAAACCCCCAAAAAGAATGGGG - Intergenic
974049810 4:56930201-56930223 TAGAACAAACAAAAATAAAAGGG + Exonic
974069231 4:57109667-57109689 TAAAACCACCAAAAAGGAGAAGG + Intronic
974757401 4:66228231-66228253 TAGAATTTCCAAAACGAAAAGGG - Intergenic
977994695 4:103487076-103487098 TAGAACACACAAAAAAAGAAGGG + Intergenic
978168059 4:105632661-105632683 TAGAACCCGAAGAAGGAAAATGG - Intronic
978262438 4:106776165-106776187 TGGAACAAACAAAAAGAAAAAGG + Intergenic
979404904 4:120297799-120297821 TAGAAAACTCCAAAAGAAAAGGG - Intergenic
979540108 4:121870894-121870916 GAAAACCCACAAAAAGCAAATGG - Intergenic
979681397 4:123463999-123464021 TAGACACCCAAACAAGAAAAAGG - Intergenic
980941479 4:139279460-139279482 CACAACCCCCAAAAAGGAAGCGG - Intronic
981010475 4:139920485-139920507 AAGAACTCCCCAAAACAAAAAGG + Intronic
981227208 4:142311436-142311458 TAGAACCACCAGAAATAAATGGG - Intronic
981721809 4:147809399-147809421 TGGAACCATTAAAAAGAAAAAGG - Intronic
981971937 4:150674112-150674134 TAGAACCCCAATATATAAAATGG - Intronic
982658595 4:158178962-158178984 GAGAAGCCCCAAAAAGAATGGGG + Intergenic
983074287 4:163306186-163306208 TAGAACAAACAATAAGAAAAAGG - Intergenic
984027766 4:174565305-174565327 TAGTGCCCCAAAAAAGAGAAAGG + Intergenic
984086642 4:175321770-175321792 AAGTACTCCCAAAAAGAAAGTGG + Intergenic
984690248 4:182718084-182718106 TAGAACCTTCAAAAAGGAGAAGG - Intronic
987732219 5:21788911-21788933 TAGAAAACCTAAAAATAAAATGG - Intronic
989230625 5:39082451-39082473 TTGTACCCTAAAAAAGAAAAGGG + Intergenic
989497717 5:42128591-42128613 TAGAGCTCCAAAATAGAAAATGG + Intergenic
989795179 5:45460692-45460714 TAGAAAAGACAAAAAGAAAAAGG + Intronic
990077684 5:51871870-51871892 TAGCATCCCAAAAATGAAAAGGG - Intergenic
993742128 5:91554548-91554570 TAAAACCTGGAAAAAGAAAAGGG + Intergenic
994285442 5:97959160-97959182 ATGATCCCCCAAAAATAAAATGG - Intergenic
994673497 5:102792113-102792135 TACAACCCCCAAACAATAAATGG - Intronic
994787126 5:104179743-104179765 TAGCTCCCCGAAAAAAAAAAAGG - Intergenic
995484630 5:112627801-112627823 TAGAAACCCAAATCAGAAAAGGG - Intergenic
995516722 5:112961656-112961678 TTGAACACCCAGACAGAAAATGG + Intergenic
998990997 5:147816684-147816706 TAGAAAAAACAAAAAGAAAAAGG - Intergenic
999022525 5:148183693-148183715 TAGATCCCTCAAAAATAGAATGG + Intergenic
999403368 5:151284703-151284725 TGGAATCCCCTAAAAGAAAGTGG + Exonic
999432344 5:151535344-151535366 TAAAACCCACAATTAGAAAAGGG - Intronic
1000233194 5:159334494-159334516 GAAAACCCCCACAAAGAAAGGGG + Intergenic
1000514278 5:162220487-162220509 GAGACCCTCCAAAAAGAAAAAGG + Intergenic
1000994721 5:167946976-167946998 AAGAGCCCACAAAAATAAAACGG - Intronic
1001800584 5:174540534-174540556 TATACCCCCCAAAAACTAAAAGG + Intergenic
1002666365 5:180828408-180828430 TAGAACCCTCAAATAGATGAAGG - Intergenic
1003361653 6:5432546-5432568 TAAATCCTCCAAAAAAAAAAGGG + Intronic
1003759056 6:9154094-9154116 TATAACCCCTAAAATAAAAATGG - Intergenic
1005425608 6:25699858-25699880 TGAAAGCCCTAAAAAGAAAAAGG + Intronic
1006215605 6:32439932-32439954 CAGAGCGCCCAAGAAGAAAATGG + Exonic
1006883532 6:37360260-37360282 GAGAACCACCAAGTAGAAAAAGG - Intronic
1008289245 6:49693493-49693515 TAGAAACATCAAAAGGAAAAGGG - Intronic
1008380440 6:50834926-50834948 TAAAACCTACATAAAGAAAATGG + Intronic
1008965205 6:57307810-57307832 TAAAAGCCCCAAAAGGAAATAGG - Intergenic
1008991494 6:57607901-57607923 TAGGACTCCAAAAAAGAGAATGG - Intronic
1009180014 6:60506139-60506161 TAGGACTCCAAAAAAGAGAATGG - Intergenic
1009608798 6:65909293-65909315 GTGAACCACCAAAAAGCAAAAGG - Intergenic
1010220627 6:73445923-73445945 TAGAACCTACAAAATGAAACTGG - Intronic
1010974050 6:82293166-82293188 TAGAACCTTCAAGAAGGAAAAGG + Intergenic
1011003432 6:82617387-82617409 TAGAACCCACAAATAATAAAAGG - Intergenic
1012021334 6:93924647-93924669 TATCACCTTCAAAAAGAAAATGG + Intergenic
1012198807 6:96379004-96379026 TAGAATGCCAAAAAATAAAATGG + Intergenic
1012857048 6:104514477-104514499 TAGAACCCCCAACAAGACATGGG - Intergenic
1014329701 6:120047156-120047178 TAGAACCCCTTAGCAGAAAAAGG - Intergenic
1014424281 6:121285439-121285461 TAGATCCCCCAAAAACCTAAGGG - Intronic
1015308466 6:131736850-131736872 TAGAGCCTTCAAAAAGAACATGG - Intronic
1016507737 6:144802360-144802382 TAGAACCAACAGAATGAAAATGG - Intronic
1016861572 6:148724310-148724332 CAGAAAACCCAAATAGAAAAGGG + Intergenic
1016887979 6:148976882-148976904 CAGAAGCCATAAAAAGAAAAAGG - Intronic
1016937378 6:149457203-149457225 TGGAACCCTCAAAAGGACAAGGG - Intronic
1017222008 6:151976495-151976517 TAGAACCTCTAAAACCAAAAAGG - Intronic
1018560159 6:165093674-165093696 TCAGACCCCCACAAAGAAAATGG + Intergenic
1019840921 7:3442756-3442778 AAGAACACACAAAAGGAAAAAGG - Intronic
1020843637 7:13254743-13254765 TAGAAACCCAGAAAAGCAAATGG - Intergenic
1022627389 7:32051832-32051854 TGGAACCTTCAAAAGGAAAAGGG - Intronic
1023476059 7:40579162-40579184 TAGAACCTCAGAAAAGTAAATGG + Intronic
1024094090 7:45970581-45970603 TAGAAACCCCAAACAGAAGCAGG - Intergenic
1024554136 7:50588802-50588824 TATAACTTCCAAAATGAAAAGGG + Intergenic
1024679301 7:51667641-51667663 TTGAATTCCTAAAAAGAAAATGG + Intergenic
1026309403 7:69170761-69170783 TAGATTTCCCAAAAGGAAAATGG + Intergenic
1026464192 7:70639765-70639787 TAGTCCCCTCAGAAAGAAAATGG - Intronic
1026631614 7:72042751-72042773 TAAGACTCCCAAAAGGAAAAAGG + Intronic
1027940291 7:84669990-84670012 TAAAACAGCCAAAAAAAAAAAGG + Intergenic
1028018994 7:85747777-85747799 TTGAACCCCCCCAAATAAAAAGG + Intergenic
1028712548 7:93926175-93926197 AAGAACCCCTTTAAAGAAAAAGG + Exonic
1028806319 7:95030657-95030679 TGGTAACCCCAAAAAGAACAGGG + Intronic
1028884500 7:95916534-95916556 TGGAAAACACAAAAAGAAAATGG - Intronic
1030739139 7:113086896-113086918 TGGACCACCCTAAAAGAAAAGGG - Intronic
1031464117 7:122087292-122087314 ATGAAGCCCCAGAAAGAAAAGGG + Intronic
1032247957 7:130229453-130229475 TAGCAACCACCAAAAGAAAAAGG - Intergenic
1033490650 7:141840407-141840429 TAGAAACCCCAAAGAGAAAAGGG + Intronic
1033808755 7:144984932-144984954 TAGAATGTCCAAAAAGATAAAGG - Intergenic
1035232731 7:157476211-157476233 CAGAAGCCCCCAAAACAAAATGG + Intergenic
1035302491 7:157906626-157906648 TAAAACTCCTAAAAAAAAAAAGG + Intronic
1036147624 8:6269462-6269484 AACACCCCCCAAAAATAAAAAGG + Intergenic
1037444453 8:18951097-18951119 CAGAGCCCTCAAAAAGAAAAGGG + Intronic
1038382088 8:27105712-27105734 TAGAACCTTCAGAAGGAAAATGG + Intergenic
1038990249 8:32859757-32859779 TAGAACCACCTAGAAGAATATGG - Intergenic
1039159271 8:34598619-34598641 TAAAACCATCAAAAAGAAAAGGG + Intergenic
1040286426 8:46102821-46102843 AAGAACCCCACAAGAGAAAATGG - Intergenic
1040304538 8:46205224-46205246 GAAGACCCCCAAAGAGAAAATGG + Intergenic
1040584025 8:48723138-48723160 TAACACACACAAAAAGAAAATGG + Intronic
1041814613 8:61955318-61955340 TAGAAATCCCCAAAATAAAAGGG + Intergenic
1041995281 8:64048573-64048595 TAATACCACCAAAAAGAAATTGG + Intergenic
1042207082 8:66340152-66340174 TAGGACCTCCAAAAGGCAAACGG + Intergenic
1042661224 8:71156589-71156611 TATAACCTTCAAAAACAAAAGGG + Intergenic
1042884897 8:73537796-73537818 TAGAAACTTCAAAAAGAGAAAGG - Intronic
1043123005 8:76353938-76353960 TTGAAACCTCAAAAACAAAAAGG - Intergenic
1045018121 8:98016795-98016817 TAGGACCCTGAAAGAGAAAATGG + Intronic
1045139522 8:99265402-99265424 TAGAAACCTCAAGAAGGAAATGG - Intronic
1045445313 8:102256385-102256407 AAGAACCACCAAAAACAGAAAGG - Intronic
1045965326 8:108017839-108017861 TGGAACCTCCAAAAATCAAAGGG + Intronic
1047089333 8:121556379-121556401 TAGAGCCTCCAAAAAGAAATGGG + Intergenic
1047198005 8:122739000-122739022 TAGAAGCCGCTAGAAGAAAAAGG + Intergenic
1047225829 8:122954860-122954882 TAAAAAATCCAAAAAGAAAAGGG - Intronic
1047259773 8:123245118-123245140 AATATCCCCCAAAAACAAAATGG + Intronic
1048349828 8:133607299-133607321 CTGAAGCCCAAAAAAGAAAATGG - Intergenic
1048896581 8:138997724-138997746 GAGTGCCCCCAAAAAGTAAATGG - Intergenic
1049833462 8:144717464-144717486 CTGTACCCCCAAAAAGAAACAGG - Intergenic
1050082529 9:1930075-1930097 TGGAAACCACAAAAAGGAAAAGG + Intergenic
1050210973 9:3255781-3255803 TAGAAGCACCCAGAAGAAAAGGG - Intronic
1050317430 9:4417511-4417533 TATATCTACCAAAAAGAAAATGG - Intergenic
1050562540 9:6849126-6849148 TCAAAACCCCAAAAACAAAAAGG + Intronic
1050674122 9:8032464-8032486 TAGAAAACGCAAAAAGAAAAGGG - Intergenic
1053557768 9:39155625-39155647 TAAAAACCACAAAATGAAAAGGG - Intronic
1053821879 9:41975910-41975932 TAAAAACCACAAAATGAAAAGGG - Intronic
1054139346 9:61463326-61463348 TAAAAACCACAAAATGAAAAGGG + Intergenic
1054608693 9:67211498-67211520 TAAAAACCACAAAATGAAAAGGG + Intergenic
1055284600 9:74714960-74714982 AAAAACCCCAAAAAACAAAAAGG + Intergenic
1055450159 9:76423844-76423866 TAGAAACACCAACAACAAAAAGG - Intronic
1055666538 9:78558524-78558546 AAAAACCCCAAAAAACAAAAGGG + Intergenic
1057022162 9:91707703-91707725 TAGAACACTCAGAAAGGAAAGGG + Intronic
1057093825 9:92285906-92285928 CAGAAACTCTAAAAAGAAAATGG - Intronic
1057217508 9:93237270-93237292 TGGAATCCCAAAAAAGATAAGGG - Intronic
1057656582 9:96958491-96958513 TAGTACACCTAAAAAGAAGATGG + Intronic
1057910132 9:99013758-99013780 TTGAAACTCCACAAAGAAAATGG + Intronic
1058106151 9:100974242-100974264 AATAACCCACAAAAACAAAAAGG - Intergenic
1058170672 9:101677401-101677423 AAAAACCACTAAAAAGAAAAGGG - Intronic
1060451553 9:123746145-123746167 TATAACCTGCAAACAGAAAAGGG - Intronic
1060683363 9:125585527-125585549 TAGAGCAGCCAAAAAGAGAATGG + Intronic
1186545592 X:10445862-10445884 TGATACACCCAAAAAGAAAAGGG - Exonic
1186740121 X:12508345-12508367 TAAAACCCCCAAAAGGGTAAAGG + Intronic
1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG + Intergenic
1187555582 X:20348095-20348117 GAGACCCCCCAGAAATAAAAAGG - Intergenic
1190691476 X:52916517-52916539 TGGTACCCCCTATAAGAAAAGGG + Intergenic
1190694507 X:52939275-52939297 TGGTACCCCCTATAAGAAAAGGG - Intronic
1191697302 X:64003415-64003437 TTCAACCCCCTAAAAGAAAGTGG + Intergenic
1192265754 X:69536842-69536864 TAAGAACCCCAAAAGGAAAAGGG - Intergenic
1192279739 X:69672344-69672366 TATGAGCCCCAAAAAGCAAATGG + Intronic
1193655335 X:84190301-84190323 TAGAACGCTGAAAAAGAAAGAGG - Intergenic
1194138014 X:90172019-90172041 TAGAACCCCCAATTGAAAAATGG - Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1195314849 X:103667495-103667517 TGTAACTCCCAAAATGAAAATGG + Intergenic
1195412975 X:104588987-104589009 TACAACCTCCAAAAACAAGATGG - Intronic
1195970920 X:110472339-110472361 TAGAACCTCCAGAAGGAATACGG + Intergenic
1196557786 X:117110596-117110618 AAGAAAACACAAAAAGAAAATGG + Intergenic
1197279964 X:124523706-124523728 GAGTCCCCCCAAAAAGGAAAGGG - Intronic
1197657469 X:129132734-129132756 AAGAACCCGCAAAAGGAAACTGG + Intergenic
1198834473 X:140787891-140787913 TAAAAGTCCCAAAAAGAAAATGG + Intergenic
1199297401 X:146174676-146174698 TAGAGCCTCCAGAAGGAAAATGG - Intergenic
1199747226 X:150780239-150780261 TATAATCCAAAAAAAGAAAAAGG + Intronic
1200483807 Y:3742273-3742295 TAGAACCCCCAACTGAAAAATGG - Intergenic
1201539768 Y:15093429-15093451 GAGAACCCCCCAAAACAAGATGG + Intergenic
1202082327 Y:21096702-21096724 TAAAAGCAGCAAAAAGAAAAAGG + Intergenic