ID: 1088631197

View in Genome Browser
Species Human (GRCh38)
Location 11:111775367-111775389
Sequence CATTTCGGCAGAAATCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088631195_1088631197 -6 Left 1088631195 11:111775350-111775372 CCTGGACACGAAAGTCACATTTC No data
Right 1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG No data
1088631192_1088631197 3 Left 1088631192 11:111775341-111775363 CCAAGATCCCCTGGACACGAAAG No data
Right 1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG No data
1088631191_1088631197 9 Left 1088631191 11:111775335-111775357 CCAGTGCCAAGATCCCCTGGACA No data
Right 1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG No data
1088631194_1088631197 -5 Left 1088631194 11:111775349-111775371 CCCTGGACACGAAAGTCACATTT No data
Right 1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG No data
1088631193_1088631197 -4 Left 1088631193 11:111775348-111775370 CCCCTGGACACGAAAGTCACATT No data
Right 1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088631197 Original CRISPR CATTTCGGCAGAAATCCAGC TGG Intergenic
No off target data available for this crispr